Description :
From Genome Similarity Track
Location :
Scaffold_8:1008744- 1009980
Transcript NameFunction/comments
Physo_339114Hypothetical protein

Sequence
1236 bases(100 bases per row)
ATCGGTTGATTAAGTAGATGATTAAGCTTAATCGAGTCGGATTTAGCAAATCCGACCTCCTAATTAGATCGACAGCCTAAGCTTTGTACTCTGATTTGAC
AGAGCAGTCTGTTGTGCCTACATCGCCATGTGGCAAGCTGATTTAGCTACTCCACGACTTACAAAGCCTTGGACGGCTGATTTGCATGCTAATCAGCCCG
AATGTCCGACACCCACTCGGCATTCGGCGGCCGATTTAAAGTAAAACCGACAAACGCTAATGCTGACGAGAAATGACAGCGCAAATACAGGACTTCACAA
CTTGATAAATAGATAGCAGTACAGTACATATCGACTGCTCACAGAAGCGTATTTAATGCACGCGATGCTATTCCTCGTTAGTAGGTGCGCGAAACATTAG
CTCGTGGCGGTAAGTGGTCGTTCCTCGCATTGCAGGCGGTAATGAGGCAACCCCTATTTTATTAACCTTACACCGATTTATACCCTTACCGATGCCATAT
GAAATCATAGGAATCCTCGATTTACTACTAGTCAAATCCCTCATGAACGCTGCTTTATCAGCTAATCCGCTCGGACAATCTAATCGGTTTCCACAATAAA
TAAAAACACTCCTTAAAGAGGCATTTACGTTCTTTTACTCAAGTAAACTTCGTTGGGATGCATCGCAAGATTTAAAGCTTGGCTATTGATGAAGAAGATT
GCTTTTTTGTTATGGGATAAACCCGCCAAGAAAGGCCAATAGGTTAGCTACCATTTACCCGGGCCAGGAGATCCTTCCTCGTCGGATGAGCATTATCGTT
CCTACAGAAGTGTCCCTAGCGCGCTGGTAGTCTCAGCCACAGGGCACGTTAATGTGCTGGGGCACTGCTATGTCAGACAACCAAATCAAAGAAACACACG
CACCGTATTAGAGAAAATATAGGAATTGCTGCGGGGAGTGGCTTCTCCGGGGACGCCGGAAGACACGCAGGAAGACTGCGTCATTCAGGGTAGAGGCGGG
CAAACATCTCGTTGTACTTTTCCACCAGGTCCTTGTCTGATGGGTCAAGACGAGTCAATGCATCCTTCGCTTCGTCCTTTGTAGGCAATTGGTGAATGCG
TTCGGAGATGATGTTGTACTGTTCGAAGACCCAAACGACAAATGGGTCCTTTGTAGCGCGCTTGAGCCAGGCAGTTCTGGTCTCGTGCATGCGGCGCTCC
GGTAGCTTGGTCACAAGTTCCTTCCGTCACCGTTCC