Description :
From Genome Similarity Track
Location :
Scaffold_149:100872- 105182
Sequence
4310 bases(100 bases per row)
TTCCACTCCGACCCACGGCCCAACGTCTCCAGCGCGTCGCGCCGCCCCTGCCTCGTCGGTCCCAGACCCCCAACTGCGCTCCGCAACTGCTCCAAGATCA
TTTTCGTCTCTTTCTGTGGCAGAGTACCACCAAGAGTATCGCCGTCGACACGGTCAACGCTCCATGAGCCGTCAACACGAAGAGAGCAAAGCTCAAAGCT
CGTCAGAGCCGCGGGCGCCGCCCAGAGGGAACGATGTTCTGTTCTCGGAACTGGAAGAGGGCGAAGTCGACAACGACGAGCCCATGGGTAGTGAGGATCA
CTCCAACCCAACCTCTCCGAGGTCGCACACTGGTGCCGCGTCCTCCCCAGCTTCCTCTGTGAGGTCTAGCCGCTCAACGGCGCGATCTCAAACAAGAAGA
GACCTGCGGACACCGCATCCGTTCTCTGAGCGTTCGAATCCGATTCGCGCGCTGCGCGATGCGCCACCGCTATCGTCGCGGTATGACAAGGAAGATCGAT
ACGATCCCAACGTCATTACGAATGTCCTGGACGAGGCCCAAGGCCGTCAGTTGTCCAATGAGCAGCGCTCGCAGTCGTTCCGACCTGTGGTCCGACCACT
TGTTCTAACGTCACGCCGTGACTACGGCTATCAGCCGCGGAACCCTGCCGAAGCGGCCCGCCTCGCGGCGCAGCAGCCGCTGAACACGTACACGTGTGGG
CCTGCGGCCTCGACTGCTGATGAGCAAGTGCAACGGCACCGGCTCCGAGAGCGATATCTGACTCCACAAGTCACAACTCCTCAGGAGTATCAGGCGCGCC
TGCAGATGCAGCTAAACCGCCAACCGGTTCCCTCTATGCGAACCATTCCGGTTGCTCTCAACCCTAGGGAATCCCAGCGTGCTTATGAAGCACAATTCCG
AAGCTGGGTGGAGGGAGCTCGACGGCTCCCCTCCTACAATGCTCTTCGGGAACGTTTCGTCTTGAGGGACGTTTGCGCTTAGACTTCGCTAAGCCGAAAG
CACGTCGACGAACACTGAAACCCCGTCCCCATCACCTCGAGGCGTCATTACCTCTTGCTCATGCTGCGAGCGCCGCTCATTCCTATGAGCCGGCTGCTAC
AGCTACTGGTCGACGCTTTTAATCGGGCACACTCACCGACCTGTCATCCCCGCGTTCTAGCGGCGGGAAGCGCTCGGTGGCTGACGACGCGGTGGTACGC
CGTAGCGGCAGGGCAGTGCGTGTGCCCGATTAAAAGCGTCGACGACGTCAGGGCAGTCCTGCCGGAGGACAACCTCAAACTCCCAAGCGTTTTGTGAGTG
AGGATAACCCCTCCATTTCACAAGGTACTGAGTACGACCCTGGCGCCTGCGCCTCGCCACCAGGCGTTCCACATGGAAGTGGAGCTCACCGTGCTCGTCG
AGCAGAGCAGAAGGATGTCGAGCCTCAGCTGGACTCTCGCGTCGCGAGTCGCAGCGACGTGTTCGCTCTGGAGCAGCGTGTGGGTTCTCTGAACCAGTAT
CTCCATGATACGACTGACTCTCTGAGTCGCCTTGCAGATAGTCGCGATGAGACAAACCACCGCGTGGACTGGTTTGAACAGCCACAGTCGGTTCAGAACC
GAGTCGCGGACCTTGATCGTCAAGTCGCTCAGCTGCAAGGTCAAATCGATTTGCTGTTGCGTCTTGTGGCCCCGCCACCTGCTGTCGCTCAGCCTGCCGT
GGTTCGGCCTCCCGCTGTTGCGCAGCCTGTCGTGGCCTAGCCACCGTTGGCGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGATACGGCTTGAGTA
AGCCAACGTAGAAGACTGGATGCGTGCGCATCTTCTTCGGAAGGTTAAGCGTATACGCTAGGCCCTTCTTGACCACGACCTTGAACGGTCCTATAAACCG
TGGTCTCAATTTTGTCTTAAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTTGCATTTAATAAAACTTGGTCTCCGACCTCAAACCTTTCTTCATTG
CGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTTAGTCTCGAAGAGACAAAGT
CATTGACTTGCTTACGAAACGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGTCACTGGTTGGCGGCGTCAGTGG
GACGCGAGGGGTAACCAGGCCGCTCACATGGAACGGAGTGTAGCCTGTCGAGGAGTGCACTGCATTATTTAATGTGAACTCAACGAGTGGGAGCATCTGG
ATCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGGGGATATCTGCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTG
TGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTTCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCC
ATGTTGGCGAAAGACTCGGTCAAAAAAACAGCAAAGCTGTACCTTCACCATATATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCAATCGGTC
TACAAAGACCACAATACCCGTGTTTCCTGCCTTTTCCTCGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAGGCAAA
CTCGCCAATGGCGCTGCCATGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGCGCCACC
AGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTTATAGAGGATTCGATACTTTAGATCCTC
ATCATGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGC
CCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCGTACGCTCCGCGTATCAAGT
CAGCCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCGGGTCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGAACTT
TACCTCAAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGGGACGCAGTGCGTAGCGACGCATGATCAGTA
AAGATCACAAAAGGCTTAGAGCCTAGTAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCTAGTAGCTCTTTGTCATGAACTGAATCGTTCTTCT
CTGCATATTTGAGCTGGCGAGACTCAAACGCAATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATAGGAGGCGTC
ACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACG
TTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCACGGTACTTGTGCAAGTAATTGGCTAAGCCTA
GCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCA
CCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGCGGTCA
ATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGGCTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAGCT
GCGTCACAAGATGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAG
CGGAATGTCGCTCGCTCGCATGAGCAATTGGTAGTAACCATCGACCAAGTCGAGCGCACTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCC
TTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACG
TGGGTGTCGA