Description :
From Genome Similarity Track
Location :
Scaffold_1:100860- 102298
Sequence
1438 bases(100 bases per row)
AAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAACAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAAAC
ACTTCTGGGTTTGAAGCATAAAAGTTAAGGTATTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAATATAAGTGACTCTT
TGAGTCGAACGTCTTCCTCTGACGCTGAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCCCTCCTGGGTCGATTGACTATATCCT
CTGCGAGGATGGAACACCCCGTGTTCGCGAATTTGCCCCCGTCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCA
TCTTGCATCGCAAGGTCCAGAGGCGGTCACCGCCAGGCTGGAAACGTTCTCCCGCTACGGGAACGCGCTCATGGAGCACGTCCAAGAGAAAATGAGCGCG
GCAACGGCGGCGGCGTCAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCGGGACC
CGTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGATGGCTATCACCAGGCTTGGAGGACGCGCTCGCGAATGGG
CACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAACTTTCGCGCGTGTTCGCGCCGCCTAATCAGGTGTACCG
TATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGCGTTGAGAACTCTTATCGCCGGAATGGCGGCGGATCCT
CTTCCGGAACGGGTCAGCGTGACCGTGTTCATGGAGGGACTTTGTGTGAGCGCAGCTCGAACGGAAGTAGTCCGTGTCCACCCTAACGCTTTCGAAGAGG
CAATGAATGTAGAATTAAATGCCGAGCACAACTTCAGGTCGGTTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGA
CCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGAAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGACG
GCATATTGCCCTCTGCGCAAGACGCGCGGGGCTCCGGCAAGCCGACCCTCCGGGTCATCGCCGGGAAACGGCAATTCCCAGTAGGCGCGGGGCGGCCTAC
TGGGGAAGGACTGAGTTCTATTGTGCCTCGAAGCGGTAGAGGGCTACGGGGCTCAGCCCCGAAGAGAGCTGGGCTCTCTTACGAGAAGCGTGTGTGCAAG
CCGGGCTTGCTGGTCGTGAAGGGCTTTGCAAAGCCATG