Description :
From Genome Similarity Track
Location :
Scaffold_590:10086- 11303
Transcript NameFunction/comments
Phymu_g11018conserved hypothetical protein
Phymu_g11019hypothetical protein

Sequence
1217 bases(100 bases per row)
TGTAGTTTAGACGAATTCAATTCTGTTTACACCATTTCCCGAGCTGCTTGCAAGTTTTACCAGGCAATGTAAAGCAGAGGTTTTAAGCCAAGAAAAGTTC
ATATTTCCCAACATCTGGCAATTTGCCTATTACTCGTTCCAACCAAAGTGATCTACGCTTAGGTTCCCAGCTTCATGTCTTcaccacgcgctgctgcatc
gcaaGCTTTGTATGCGTGGCGCTCAAAGCCCCAAACCAAACGCCGCGTAATCGCCGGCAATGCCACCCCGACCGACTCCGTCACGATAGCCAGCCTGTGC
GTTGTGTACGTGTCGAACTCTCCTCGAATCAGTAGCTCCTGCTTCGTGGCCGCCAAGTAAGCGCGCATCTCGGCCTTTAGCACGTTCCAGCACCTCTTGA
TGGGGTTCAACATTGGGCTGTACGGCCCGAGCCGCATCAGTACTGCCTGTTGCCGTTCATGATCCCGTCGGACACCAAAAGCTGGCGCGTCAAGTCGTCC
ATGCGGCTATGGGCAGGCATGTTGTACGTCACTATGACGATTTTGCTGGTTGGAGGCAGCTCTCGGTACTCGCCGATGTGCTGGGCGGACACGAAGATGT
CAGCAATGAAGCGCGtgttctcgtccttggtgaCCGATCCGTCGTGAGTTCGTAGGAGGACGATACCTGTCAGTACAGACACACCTCCTCGGATGTGCAG
GTTCTTCCCTTGCGAAGGTGGAAGTTGGACAACGGCGCGCTCAGCCACACGCGACCAGCCTTCCGTCCTTGACAGGTAGAGGTTAAAGTTCGTCTCACCC
TGGTACACAATCATGTCGCAATGTgctcttcgagctgctcgacgaACTctttgcgcttctccttgttAATCGAGTTGGCCATGGTGGCCTTTCGACCCGT
AGTTTCTTCGTACTGTACAGCATGCCTTGCAAGGTCCTGTGGATGGAGGATTTCCCTACAGCAACACCCATGTCACTCAGCAGCCTATCACGCATATTCG
TTAGCGTTGCACGGCAATCTTCATCCAGATACTGCTTTAACTTCGCCATGACTTCCACCGTCATCTTCACACAACCCTGACGGACGCCTCTGCGAGGCTT
TGGCGGCCTAGCCCCTTCAACGAATGCATGGCGAGCAGTAGCGTAGGGTAGGCCGTTGTGGACGGCAGAAAGGGGCCAGTCACCGCCCTCAGTGAAGACG
CGGCGGGCGCATGCTAT