Description :
From Genome Similarity Track
Location :
Scaffold_14:100848- 102403
Sequence
1555 bases(100 bases per row)
ACGACACGAACCAAAGCCCAGTCACATGCGCCGGGTGGCAGCTCGGGCACAAACGCTCGCCGTCAAGATGCGGCTACACCAGCGCTGACAAGCTCAGCGG
GACCGACGAAACGCCGCCCTGCTCGGAGAGCCTGAAGATAACTGCGACCAGTCCACACCTTCTGCGATCGATGACTATCAAGGTGGGGAAATGGACACGG
AGATGATCTCAGCATCAAGCGATGAAGATGTGGACATGGCACGCCATCTTGAAACGGGCTTCAAGAGAATTGAACGCTCGTTCGCGGACAAGAAACCGTT
CGCGGAGCTCGACACTGTCGACTGCGAGTTTGACGATTTCCAACCGGATGCTCCCTCAGACATGACTCCAGGGTTTCTGATGGTACCGATGATAAGTCGT
CCGACGCCTTCGCAAGAACCTCAACCTACGAAACGTCGCTCTGCGATTTAAACAAGCCCGACAAGCTGAAAGCTGCAGCGGAAGATGCCGTTCTCGTCGA
CGCCACTGAAGCCCAGCTTGAGCAGCGTGAAGATCGGATGACCCAAAACATGCAACACCTCGACTTGGTGGATAATCTACTAAGTGATACGAAAAACATG
GATAAAGTGGTTGAATCCATGCGAACGTTCCCTACTGCGTGGTCGACAGTGATATGCAGTGACCTAAACGATGGAGGCGTTAACTTCTGTGAGCTCGCCG
ATATCCACCTGCTAGATCGCATCCTTGCCGCCAACATGCACAACGCCAAGATGGCCTTCCACGAACGCGTGGAGGCATCTCAACTGCCGTTGGGGAAAAC
TCGCACAACCTACATGAAGTGGCTGGGTGGAGCACTGGATGGTCAGCCTGACCAAGTGAAAAACCAGTGGGAAATTTTCCGCTTGCTCAGCTCCTTTGAG
TTGCTGGTCATGAGCACATGCCCGTTCATATTTGGATCTAATGAATGATTGAAGTCTCTTGTTGTCGATGCTGAAGACGGAATTCCACACGCCCATGTGA
AGATGCTATCTGATGCTACAATCCTTCGGCTGCTACGATCTGCCTTAGGGCAGCAACTGCTAGAAAAGCTGCTTGAGCTGGTACCCAACTGTGGTGTGCT
GGGGCGCATTGAAAACTTGCGCAACAGCGAACGACTGCCGGAGGAATTGCTTTCAGTGACTTTGGATTGCCTGTCGCCCAGTGTAATGGCGAGCACTGAC
AACTAAGATGGTCATGGGAGTTGACGTCGGCCAGTCATGTAAAATATTGACTTGGAATGTACATGGAGTGCGGACAGGTGGGCACAACATCATCTCGTCG
CAAGTGAAGTACTATTATTTTTCGAGTCGCAGACTACTGCTTTCCCTCGAAGCGGAGGAGTGGCGACAATTATTCATGGCTCGTGTCCTGGAGTGGATGG
TCGTATCCAAAACTATTCCGAACAGATATTTGCAGGTCCGGTTGAGCTGGAGTGATCACACATGTTATATCCATACTATCTACGCACCAAATGATGCAGC
GGCCCGAAAGACATTGTTCCAGCGCCTTCCCGTGGACTTTGATGAAGATGCAATC