Description :
From Genome Similarity Track
Location :
Scaffold_419:100837- 108308
Transcript NameFunction/comments
Aphin_H310_00863NHL repeat containing protein
Aphin_H310_00864PREDICTED: PAX-interacting protein 1-like
Aphin_H310_00865Hypothetical protein
Aphin_H310_00866PREDICTED: PAX-interacting protein 1-like

Sequence
7471 bases(100 bases per row)
GGCGCCAACCCAGTGGCAAAAGGGCACGTGCTTAGTCCAGTTTGCCCGAACGTGCCCGTCCTCGGCATCGCCGATCGTGTCTGTAGACCCGGACGCGACG
TTTCGTCCGATTGTTCAGTACTCGGCCGTCAATGCGACGCGGGTCTTGTCGTACGAAGGGTGCGTAGACACAGTCCGACGCGGCTGCTTCAACAATGGCA
CGTGCGTCGCGCCAGACGAGTGCGTGTGTGCGGCAGGCTGGACTGGCTACGACTGTTCGATTCCGATCTGCGAGTCGCGTTGCATCCACGGGGTGTGTAC
GCTTCCCAACCGATGCACGTGCGACTTGGGATGGACGGGGGACGTGTGCTCCGTCGCGATTTGCGCCCAGGACTGCCGAAACGGAGGTCGCTGCGTCGCG
CCGGTACGACGTCGTGTGCGGTCGAGTCGCCGACGTGAGGGCATGTGTAGGACACGTGCGAGTGCACAACGTGGCCGAGTGTGTGGCGAGATGGGCGTCA
CAATGGCGGCACACCGATCTTTCACCTCCCGGATGGGTCGCCGCAGCTCACAGGGTATTCCAAACCCGCCCTGGACCGTCGCCCTCACGACTCGTGCGGG
TGTAGGTGGACGGGGTACGACTGCAACACACCCATATGCACCCAAGCCAAGCGGTTCGTGCTCAACTCGATCCGAGACACACCGTCCTTTGTGGCCATGC
GGGGTACGTCGGTGCGCTCGACCTGGATTCGGAGCCAGTCCGTGTGTAGCCCGCGATGGACAGCATTCAACGCCGCAACAGATCTCATGGCGCGCACTGT
AGGAGCCTTGCACAAGCTGCCGTGCGTCCACTTGCGGTGTCCGCAGTACGACATCGAGGTCACATCAAACGACGGCACGTCATTTCAATCCGGGTGCGCG
CCGGGCATTCCATTTCCCAACCCAGTGTTTGCCGGCACGTTGGCGGAGAAACAGAGCAACTGGGACGCGTACAACGACACAGCCACGACGGGGCGGCAGT
CCGCGTCGGCGCTGTGCAGGGTGCTCCAGTGGAGGCAGGGCGAATTTTCCCACCGACTCGTACGGACCAATCACCCCGGGGCGGACCCAGGCGAAGGCGT
GTACGAGTGCTACAATCACGGATCGTGCATCGAGCCCGACGTGTGTAGCTGCGCCGACGGGTACACCGGTTTTGACTGCCAAATCCCTCTCTGCCGGTAC
ACGACGCCTACGGGCGATGTCACGGGATGTCAGCACAACGGAATTTGCGTCTCCAAGGACACATGCGAGTGCATCCAGACCAAGTCGGTGCTGCACCAAA
AGTACCCCCTTGCTCCTCGCGGCAACACAGGGTGGGCCGGGTCGAGTTGTTCCATGGGTGCGTGCCGCTCGCATACGAGTCGCATGCCACTGCACTGCGT
TCGTGTGTAGCCATCTGCGTTCAAGGGTTCTACGATGCCCAGTGCTATGGCCAAGCTCGAGTGGGCCACGAAGGGTGCTATCGATGCGCCAACGGTGGCA
TGTGTGTGGCACCGGACCTGTGTCAATGCGCAGACGGCTGGACAGGGTACGACTGCACCGAGCCCGTGTGCAAGGTCAAAGTGACGCCTGAGATTCGAGC
GCAACTGTTTACCGTCGACGAAAACAAGGTTGGCGTGCCGCCACTCCTTGCCGGAACGTGACTTATTTGTAGGTCGTCGCGTTTGAGAACGATCCGTGCG
GCACGCAAGGGGGGCGGTGGGGCAAAGAAGTGTACAACGGGGCTGAAATGGGCCAAGGCAACTGCACTTTGCCATACCTATGCACGTGTCTGTGCCGGGT
GCGCTACGATGTAGATGAGTGCAAGAAGACGGGCGAGTTTTGCTTGAAGCCGTGGTCCGACGTGTTTGGGCGTGCGATCCCTGCGGGATTCATCTTTGGG
ACGAAGCACTGCTCCAGTGGCTTTCAAGGACTTGAAGATAACCAGGGGCGGTTCCAATCGTGCCACTTGCAGATATACGAGCCGACGGAGTTTCAACGGT
ACACGGCGTCGTTTGTCGCGTTCATGACGATCGCGTGCATCCTGTTCATGGTGTCGTTCTACTGCATTCGAAGAAACATCAAACGCCGCAAACTTCTTCT
CAAGGCAGAGAGGCGGCGGTCGCGGCGCGAGTCGGAGGAAAACCCGCTCAACCCCGAGTTTGCATTTGGTCACGCACAATGACAAACATTCACGGAGCGA
TTTTCCGAAGTTGCGGAAATGTTAATTTTTTGCAAATATTCGACAAACTCCGAATTTTTTCGTTTTAATATTTCGAAACCTCCCAAAAAGACAGTCCGTC
CCACGTAGGCGGAAAAGCGATCAACCCAGCGACACCATCACGCCGCCGCCGCCGCCGCCCCGACGAAATGCTCCCGGCCCGCGGGGCAAAGTCAATCCTA
CGTCAGCAAAAGCCGTCCATTGATTCTTGCGAAGGGCATGACCAGTCCACGCAAGTGGTCGCGCGACCTCTCACGAAGAAGCAGCTCTCGTTTGCAGACG
ACCATGGAATTGCTTTGGTTCGCATGCTGTCCCCGCGTCGACCAGTGATCTCATGAGTAATTCTGTCGCATAGGAGCAGCATCTTGAGTTTGATGTCCTG
CAGTCATGGACGATCGCACCAAGCCCTCTTCAAGCAAGGCTGTGAGGATGTTGACCATTCATCCACCATTTCCACGAACACCCCCCGTGCTTCCTTCCCT
GCCGTCGACGTGAGCTCTTCAAGCACATTTGACGGAGCAGCAACAACCACGCAAGTTAAATTAATTCTTTTTCCTGGAACCTCTGGGTTTCTTGTCATGC
TTGTCAGGCAGCGCGACGTGGTATTCCGTCAGAGCCAGCGACTGTGTTAAGATGCACCGCAAGAGCAATTCCGGCGTGTAGCACTGCGTCGGATCCACTC
GTTTTAGGACCTTTTGAACCGTCGCCGCCGCCGCAGCATCCACGGACGTAATGACCAATGTGTTGGGGCCAATCTCGGACATCCCATGTACCTGCACGAA
TGTCCACACGTGAATCGAGATTCGTAGGATAGCGCTTCAAGGTACCTCGCCCCCTGCGCAGGCAATGATACGCTCCAAATCTTCTGGCGGCGGCAGGACA
GTCTTGTGACGTGTAACGTAGAACGCTCGTCCTCGTAAGAGGGATTGGCGTTGGGCCAGAGTGTAGTTGTACATGGTGGCATGGAGCGAGCAGCCCCACA
GCTGCTCCTTGACAGGATCGGATAGACAAAACGATTCTTCCGGCGCGGCGTGGCCCAATTTTGCCGACTCGTGGAGCCATTTTTCGTCCAGGATGTGCGA
GCAGCATGATATGCCACACAAGATCTTCACTGTGCGCTTGAGGACGCCAGATGGAGCAATGACGTGGGTTGCGTGGGTCACATCGTCTTCGTACTCTGCC
TGCTGAATACTCGAGATCTAGCCACTTCGTCAAAAACAGACAGCCACGGCTGGACCGTCAACAAACTACCTTGGCAAGGAGGTTGTTGGGTGTTGAAAAC
CCTGTCAGCGCAATGCGAATTCGCGAGATAGCCGTCGCGGCACTGCGCTGTGGTTCTGCCGCACACGAAAATGGAACATCCCGGAGAAATTGAATCGCAC
CCCCCTCCATTTCTTGAGTGGACGGTGGCAAGTCGACCAGAGGTTTCGAGGTTGACTTGGATTTCGTGGATGGGGCTTTTGGGGTGGAGTGGTTGGGCTC
AGCGACAGCGTTGGCGGCCGCCGTCGGGGTTGCACTCTTTCGCTTCTTCATCGGTCGTCCCCGCTTGGTCGATTTCGCCTCGGGTGATGCTGGTACTTCA
GTCACTGGCGTTGAAAGTTGCCGAGTAGTTGTGAGGAATTGAATCGTGCCACTTTCCATGTCTTGCGTGGATGGAATGCGTGAAACAGTTGATCGAACGG
TATCGTCGACAGATTCGCTGATAAATTTGATGGCACGCTTGGAGGGCGGGGAATGGTCATCACCTGTAGTCCGTCTGCCGGAAGTAGGCAGGACATGCGG
GCGTTCCCGCTCATCGTCTTTGGCGTCGGGAGTTTCGGCGCAAAATGTGTCGTCCAACGGGGCGGGTTCATCTTGCTTGTCAAGGATTTGTGGGGACTGG
ATCCGTGTAAACGACTGCATGTTTGTATTTTTCGCGCACAACATCGAGTCCAAGCTGTCGGCAGCTCGAGCCACGTCATCGCCGCTGTCAATTTCTGTCT
CGGATGTGGCCGGTGACCCCACCAAGTTGTTGAGTTGAAGCATGCGGGCCGCAGGAAGGGGCTTGGACGTCGGTACAGCGATCGAGTCGCTGCTGCCCTC
CTTGTCCACGGAAGCACTGGACGAGAGCGTTTTCAACTGTTCTGACGATGTCGCCATCGTGGTGTGGGAGGTAGCGATGGACGGGGAAGCGGCAAACAAG
TCTTCGCTTTCGTCGGAGGTTGGGACGACTAGGCTATCTCGGAGACGGTGAAAGTGAGCAATCCAGTCCATGCGAACGGTCATATCCACTGGCGCGACAA
GCAATCGCAGTGCGTCGCCATCTTCCTGGGCGACTTCTACCTCAAAAGGACGGTTGAGTTGGCAATGCTGATCGGCCAACGGAGGATCGTGGATATGAAT
GTGCTCCCCAAGGATGTACCCGACGAAGCGGCATTCGGAGAGGGTGTGGATGCGGCCGTAGAGGACCATGTCCTTCATCAGGTACATTTGGTGAAGCCGC
GGAATCATCGAGTGCCTGGGATCGACCAGCCACATGGCAGCCGACGCGACCAAATCATGGTTGGCCGTTTCGGTGTCGGCCACGAGCCAAGACTTTGGAA
ACTGCTGCATGGACGCAAACAACGCATGCAAATCAAACGATAACGTCGACTGCCGACGGGTTTCAAAACATTTGTCCAGGGCAGATAGCCACGCAGCGCA
GGCTTCTTGCGACGAAAAGGTTGCGTGGCAAGTCGAGACGGATCCCAGCACCACCACGGTCTTCGTCGAGACATCGAACGGCACGATTGTGATGGGAGAC
GTATCCTCCAGGACCACCAAGATGGAGCCATCGGAAGCACTCTGCGCCACCAGCACGCCATCAAAGAGAAACGCTTTGGATTCCACGAACTTGTCGGTCT
CATCGGCAAATTGAACGGATTCCGTCACGTCGACGAGAACGCGCCTTGTCCAGTCGACATGACGAACCTTGGTCTCAATGTCTAACTGCTCCGAATGACG
CAATCTCATGGATTCAAATGCTTCCTTCGCTCCACCATCCAAGAGCGCGATTGCCGTTAAGGATGCAGGGATGTCCGTGGCGTGCAGGGCATGCAGACAT
CGTTTGTACGCATCCAGGGCAGTCAACGGGCGATTCAACAATTCTAAAACGTCAGGCTGAACCGTGTGTTGCTTTGTTGCTTGGGTTGCAGCTTGGAATT
GAATGGCATATGCTTCGTGGACGGCAGCGACATGGTTAACAGACTCGATGAGGATCGATATGACGCGTTGTTGCGGTTGGATGGGGTGTTCATCGAGCAC
GACACGTATCCTTCGCAGAAGGGATCGATGTGTTTCGAGCAGAAGTGGGAAGAAGGACCAACATGCCAAGTACACTCCTGCTGGGAATGCCTTGGGACTG
GACAATGCACGGTATGTAAGCGATTCTTCACGATATGCCCGGCTGCATGCAAGCTCCAAGCCGTGAACGACCGATGCTTCATTGCGCATGAAAGCGTCAA
TGTGCTGTGAGGCTGATACTTGATCCGTTGGGTCGGTCGTAGACGACATCGTGTGCGTTCGGAGGATTGCCGCCAAAGCGCTCGAGATTTAAAAAATCCG
CGGAATCCTGTTTTATTCTTCAAATATGGATTTCTCCTTGTTCACCTCATTTCACCATTTGAACCGATGACCACCATGCCCGCGTCTCCCGCGGCACCGA
TCCAATTTTGCGTGCGCAAGGGCAAGTGGGTCTTCCGCTGTATGGTCGAAAGTGATCCGCGTGATTTATTCCACCGACGGAACTATGACTTTGTCCCGCA
GCTTGAGTACGTTTTGTCGCGAACGCAGGGTGTTTATGGATGAGCGTGACCTTGCAGGTCGGGCGACATTCAGGTGACCAAGCGCGTGAGCTTAGCCGAG
CTTCAAGGGATCGTTGCAGAGTCGGTGGCAGAGGTAAGCTAGCCAGTGTCGATTTCTCAATGTCTCATGCTTGTGCCTTGCAGATTCCAGAGTTCTACAT
CGCGTCAACCACCGACGCGTCTGCCGAACATGCGACTGGGTTTGCCCAATTCCGTCACTACCTTTTCAGCCGAAACAGAGTACCCATCCATTAGCAAGTG
AGCCGAGTCGTCACTGCAGGCATGGTAGGCGGGAGTGGCATCTCTTTCGCCTCAATATTGGCTCATCTTCCTTCCCGACGACATCGACAGTCGACTCAAA
TGCCTTGTTGTCGAACGCTCAGCAATATCTCAACCCCCAGAGCAACCATTAAGGACCACCACACCTCCTGTTCCGACTACAGCTGCGTCCATGCACGCTG
CAGACCTATCAGAACTTGGCAAAAGCGCCTCGGTCGAGGTCAAGGGGACAGCCTCTCTCCAGTCATCCTCAGGATCCGCTGAAGAGACAGTCAGTACGAC
CCAGACCCCAGGAAAGTCGTCCTCCGAGAAGGGTGGCATTGGCGCATCATCATGGAACGATTTCATGTATGTGTTGTGTATTTGTCATCGTATTGTCCAT
CAAGTTGCTGGTTGGGAATATCACATGTCTCTATCGTAGACGCATCCACCGCACGTTCCACGCAGCGCAATACTTGATTCATGCAAGCGGACCGCTCGAA
ACAGCGGCCACGTCGTCGATGAATGCGAAGCGAGTAAAACACCGCTAACGTTTGCGTTTGGACACTGCCATGGAGTGCTGAATGCCAACGCGATGCTTCG
TCAGGTCCAGCGACTGCTGCAGAACCCCCGACAGTATCAACTCGGGAGTGTGCATGGGTGCGTCGATCAGCTTGCCAAGTTTCTTTCGAATCGATTTGAC
CGCCAGCGCTTCGGCGGAAGCAATCACTATCACGCCGTCGTCGTGAGCCGTGGAACTCGAGCCGGTGGGCAGCACCTGCATCACCAACCACATATAAATT
CATGTCGATCGTACGAGGCAATGTGTACCTCGCCGCCAGCGCACTCAATGATCTTCGTCAGGTCCGACGGCGCCGGCAAAATTGTCTTGTGCGGCACAAT
GTAAAATACCCTGCCTCGGAACAACAGGTGTCGATCGTGGCGGTGGTACATGGTGGATTTCAAATCGAATGCCCACTGGGCTTCCTTGGCAGGGTCGTGA
AGGCAGTACGGAGCCTCAGGCACGGGTCGACCCTGTTTCGCAGACGCAGTCAGCCACTTCTCGCCCACGATATGTTGGCAAGTTGAAATGCCGCACAGCA
TCTTGACCGTTCGCTTGAGTTCATTTGTGGGGGCCACCAAGTGCGTGCCAAGCGACACGTCTTCCTCAAAC