Description :
From Genome Similarity Track
Location :
Scaffold_37:1008- 9450
Transcript NameFunction/comments
Phyke_g2187hypothetical protein PHYSODRAFT_309136
Phyke_g2188hypothetical protein PHYSODRAFT_353495
Phyke_g2189hypothetical protein PHYSODRAFT_473874

Sequence
8442 bases(100 bases per row)
AATGTTTGCTGTGAATGGACCAAGTGGTCCGACGACGCGGAAAGAACGATGCCCAAAGAGGAAGCGCCAAcgtgaagaggaaggagaggCTAAGCAGCGT
GTTGCTGACATGAAGCGAAAGAAGTTCTTTGTGGTGCAGTCTGGGCAATCGAAGAGTTGCAAACCTGGTTAGttgacgatgctgaagcttgtcgAGGCAA
GCGCAACACTCACGTCCTCGTATTGCTGTcggtgtttgctgcagcagacaaagAGAAGGTTAAAGTGTGTGGAGTGGAGTCAGACCTTTTCAAGGTAGCT
TATGCTTGCCTGGATGGCTGTAGCTCTACTAGAACTGCGCTTTACCGGTGACTGTATGTGTTGTCAGGGCTGCCGGATTGGTTGACTTTCGAGCACAGGC
AAAGTATCCTCGTAAGTGCTAAGCATGTTGCATATGAGTATAAATTTTGAATTGGCCAAATGCAGCATTGATGATGTATAGCAGATACTATTTGGCCAAA
TTGGTGAAAGACCACGGTGGCAATGTTGCGTACGCATTCATTCGTTCCTGGGCGACACAAATAATTGTGCCACTCATTGTTCCCAATCTTTACTTCGTAG
CTCCCAGCTCACTACCACCCGCGTAACGCACATGGTCGGCTCCAACTTAAACGGCTGTAAAGCCGAAAAAGTTCTCAAGGTAGGGAAAGATGATTGATGA
CTCATTTGCCTTGCCCTTGATTTCAACGCGTCCAATTGTCTCCTTTATGCCACAGAACTCCGGAAAAATCAAATTCGTGACCTCAGGTATGTTGCAGTTC
CCTGTCAGCTGCATTGATTCATTCTAAACGAGCTTCGTGTAGCAGAATGGGTATTACAGTCCGTGAAACATAAGAAGCGCCAACCCGAATTTGAGTTCCT
TGTTTACAAGGATTCGAaagcagcctcctccatcCACGCTGCATTCTCGCGGCCAGCTCCATTGACAAAGTAATCTCGACGACAGAACAGCACTCGCACG
CCAACACAATAGAGAATCGGGCGAAGAACGCAACGCAAAGGCCAAGCATTCGCTCGTGTGAAAAAAAGAATATACCATGAAATGGAAAATATAGGGTCAC
AACTAACCAGAGTAGCATTCGTTGTCGTTCCTTTCAGCCAAAACCGAGAAACTGAAGAGTAAGGAGAAAAACTCCTGGGACCTGGGAGAGCGCAGCTAAA
GGACCCATCTCCTATCCTCGTCATATTCTCGAAAGCTATCCACCTGCATGGCACGCCAGCCTCATTGGTCTTCATCCACACAAGACGCCGAAGCCAATCT
GCAGACAAATCACCTAGCGCGCAACAGCGAGGCAAACAGGACTAGACAACACTGCTTAGCAGCACTTCGACCCGCCGTTGGACGGAACCTGCTGGCCGGG
CGTGAGCTTCACGCCAGCCTTGGGGGCCACTGGGGCGTTGgccatgcgcttcttgatctgAGCAGCCATCATCATGAAGGCCTTTTCGACGTTGGCGGCG
TTCTTAGCACTGGTCTCCAGGAACTCAATGCCCAGGCTCTCAGCGAACTCCTTGGCCGCGTCCGTGCTCACCACACGCTTGGCCGTCAGATCGCTCTTGT
TAcccaccagcagcttgttcaCGTTCTCACAGGCGTATCTGATTTAACACGTGTTCCAAAATCAGCATCTCGCCTGGCAGGTATTCATGTGGTGGCAGAT
AGTTGTAGAACTCACCTATCGATctcgtgcagccactgctTGACGTTATTGAACGACTCCTGGTCCGTCACGTCGTACACCACGATGATGCCGTGGGCAC
CACGATAGTAACTGCTAGTGATCGTGCGGAAACGCTCCTGGCCAGCAGTGTCCCACTACAGAATCATAAGAGATAAAATGCAACCAATTAGTCACGTGCT
GATATAAAGATCATAGCCCTTCCCAGAAGCTGTCACAACGGAGACGTACAATTTGGAGCTTAATGGTCTTGCCGTCCAGCTCAATCGTTCGGATTTTCTg
aacacaacaacaagatTTACAAGAGGTCAGCAAGTCTGGTACAAAGTTAACACTTCTCTTAGATCAATTTTAGCACTCACAAAGTCAACACCAATGGTCG
AGATGTAGCTCTCAGTGTACGTGTCGTCCGCGAAacggagcagcagacacGACTTGCCGACGCCCGAGTCAccgatcagcagcagcttaaACAGGTAGTC
ACTGCACAAGCACACACGTCAGTGTCAATATCCTCTCGTTAATAGCTTCTTAATATCAGGTTTTGGACGTACTATTCCGGGTTCATGTTGGAGGAttctg
gagaagaagcgggAGGTGAAGGCGCTTAATCTAATGGCAGAGCACAATAATATCCGTTAGTATCTATAAAATAAGTTTATTTCGCCCTTCCTCGCCCTTA
AAATGTCGCTAAATTAGGGGGAAAGATCGAGGATCTCGGCGCTTCCACCAGATAGAGGGGGGCGGAGCGATTTTCAAGGAGAGGAAGGGGAAGAATTAGG
CGTGGTGTGACACTGGAGGCGGCACTtacagagagagagaagagaGAAAGAGCGAAGCGACTCGCGCGTTCCGAGAGTTCTTTGGCTTGTGGCGCGAGTG
GGTGCGGGGTCCGCGTCGAGTCTGCGTTTGGTTTCCCGAAGAAAAACCGCGAGAGAAGGAACGAGGGGGGCGTTATCTTCGTAATTTATCAGGTTTCCTT
CCTTGAACGAGCGAGGTTTTGAGGTTTTATCAGAGTTTTCAACCAATAGAAGGCCTCAGCGTGGCGTTGGTAACGTGACACGCGAAGTTTACCAGCCACA
TAGAACTACGAAATGGCATACATAAAAACTAACGAAAGGAATGGCTAAAGTTGAAGACGCACATTGCATGCAGCTTGGCACCAATTCGACACACATGTGG
TTTGGCAATGCATCGATCGGCCATGACAACGAGTggttcttgctgttgttgtaAGTTGCAACGTGCGCACCGAATGGAAACTGTGCCGCTCCGATATAAT
GTAACGGAGCTTTGGTAGAAGTTGTCTTGTACGATCCCATGCGGATTGAGGTGAGTGTTGTTCCTGTATGCTCACACGTCAAAACTCTTGTTGTCATGCC
AGAGGAAATGAGTCGCAATTGAATCTTTCGCACAGTTCGTGGAGCCTCGGACCGATGCTGTTCCGCATGCCGTCACAAACTGCCAAGCCATGGAATTGAA
GACACCTCCTCCGGTGGCGCCGGCCAAtgatcagcagcacagaaCAGCAAGTTCAAGTCTGTCCTAGCCATCCCGCATGTGCAATCGGAGCGGGCAGAGT
ATTGTCCTGCATGGGACAAGACTGATTCGAGAAGCCCTAAATTGGTTCAACCAGAATGATGGTCGTTCGTCCTCGACCTATGCCACTTTTACAGACTCTT
CCGCGATAAATTAACACGTCATGTTGAATCTGGTTTTCAATACATTCCTTTGTCAATTAACCCATCTTCTGTGAAAAATAAGACTAATTAGATCTCAAAT
ACTAGATAATTAGCTCCTTTTTCTCCTAGGGTTTCGTTTCGTTGGAGCCTTTTTGTTCCGCCTTCGGTCTCCCCCCACAAAGAAAGTGGGGAAGTCGAGA
AGAAACGTCGAAGGCAAGTAACCTGTCCGAGGCGCTAGCGGAGGCGGCTGTAGTGCTCTCTACACACCTGCTTCCCAGCCCGTATATATTCATATCAACA
TACATGTATCTTGTGGTTGTGCACCTCCAGTCTGTGTCTTTGAATCTCTCTATAGACCGAGGACGGAGACGTAATCCGCAGTCTATTTTTCGTGGGGAAT
GATGCCTAGAATTCCCTTCCAGGAGGACTATGGCTGTATAAATTGCATATAACGAGGGACTATCCTGGATAGCGACCTTTCAGAGCAAATACCTAGAGCT
TTGAACGTGAAAAGACTGACTTATGTGACTGTTTATGATTGTTCTGCTTGCAGACGTTTAGCTCGCCAGAAGAACTTAAAGGAAGAATTGCAGCCAGTTT
TTGCAGTCAACAATGAGCTCATTCAAGAAGGAACACCCATTCGGTACGTCGATCAGGGGCTTTGCGTCACTGGTTGGAGCAATGCGAACGGGAAGCCTAA
CGACGTTTGATGGTGCACTTTACAGAGAAGCGCCAGGCCGAAGCTCAGCGCATCCGTTCTAAGTACCCCGACCGAATCCCGGTATGTGTATTAACGCTTG
CAAACTGCTTGAGTGACAGCAAGCTGAGCTTCTATGTGCGATGTGTTTATTCAGGTGATTTGTGAGAAGGCGGATCGCAGTGACATCCCGGACattgaca
agaagaagtacTTGGTGCCAGCCGACTTGACAGTTGGCCAGTTCGTCTACGTGATCCGAAAGCGCATCAAACTGAGTCCTGAGAAGGcaatcttcatctt
catcaacaacgtCCTCCCTCCAACGGGTATATTGATTCTGTCGAATCTGCAGGTTATTAACTTGTGGGCGTATTAGTAACTTTTTTTTGGCGTTTCGTTA
TAGCTGCACTGATGTCGAACATTTACGAAGAACAAAAAGACGTGGACGGCTTCCTCTACATCACCTACAGCGGCGAGAACACATTCGGTCAATAGGCCAC
ATTTCCTGATGGCACATCTGTGCGAAGGCTGGATTTTGGTTGAAGATTTTTTTTCGTCGTCAAGGTGGTGAGCATGGGTTCCCGTGTCCTCTTGTGCTAA
GAGCTGCGACGTAGCTATTTAGCTTACGGTACCAGTCGTTTGCAACGAGAAAGCGATGACgaatgaagacgacgaacGACCTCGACACACTATACGAAAC
ACGACAAGAAATATTTGCTGCTATGTGTGATCCATTCTTTAAAACTGGTGATGTGGATATTTCCTAGGAACAAAACCCCAGAAAAATGCATGCAATTCTA
TTCTCTTGTTCAAGGCTCCTGTGGTGTACTTCGGAGCTGGATCCGTACTAACACTATTTCTTTATTCCCGCTGGAACTGCAGAACCTGCAGGCCTTGGCC
AACGACCACGACGTTGTCGACTCCTGTGTCATGCCCCTCTCTTCGAACTGCTAGATCGGCGATATCTGCGCATTCCGAGAaagcagcactttgccaTTCC
AGATGGGCATCAGTGCTATGCTCGTTGCGAAGGATGTGCCACTTACTCACTCTTTGGTCATATCCAGCAGCGAAGACGACTTGAGCGTCCACGCACGCTA
CTGTTTTGATAGCTGATCCGCTGGCATTGATTGCGCGTGCCTTCCCTAACATCTCGCATGACGGGAAGCGGAGCTCGCACAGGAACAAATTTTGgtcatc
gccaccactgATGAGAGCCACATCCAGAGTCCCTTGGTCCTGGGATTGAGTGCAGGAAACCAGAGCGATGCAATTTGCGCCCATGTCGTGCGCCAAATAG
CTTCCACTTGGCTGCATGTCTTCGATTACTCCATGGATTTTGTCGCTAATACACGTGCCATCATTGTTAAACGGGAGAAGCTTAGCAAGCTCCTCTAACA
ACACACTCAAGTTCCACAATGTCACCAAACCATCGGTAGAGCCAACCGCAAGACCAGCAATGATACCATCGCCGTTGTTTTCCTGAAACCCGACGCACGA
TAAAATGGGTTTTCTCGAAACTGAACGGCAGTCACCGATCTCAACAAGCTTGCTACGAGTCAAATCCAATAGCAAGAACTGGGTGGAGCCTTCCGAATTA
CAAGCCGCCACTAGTCGATACGCGTTCGAGGCAGTGGGGATGACAAAAGTGGCGAGCCCAAGGATGCGGTGGTCTTGTGCTGCCTCGGCACGTTCATGGC
CACAGACGTGGCGTAGCAGATCACTTTCGCCACAAACTAGCCACACGTTCAGGCGTTGTTTTCCGCCCCCAGAGATCACGATATGCTCTTCGACATTGTC
ATCACCTTCGCGACGGAAAGTCGTGAGTGCTCGCACAGTGGTCGTATGGGCAACGCCTGTTGCCACACTGGTCCAGCGCGAACTCCTGTTCGTATCGCAG
TTACTACGAAAGCGACGGCGATGGAGCATAAGACTATTgtcctctgctgctgtcacaacACGCTCATTTCCGAGGAACGCCACGCATGTTGTCATCCGAC
CATGGTGATGGTCGTGTAACGAGCATTTGGAGAAGATTGGGGTCTCCGAACTGCGATGTTTTAGCAATGTGGAGTGAACCTTGACTTCTACCTGCTCCTT
CAGTGTGGCGGGTGGTGTAAATACAAGTGTGTGAGAGGGTACTGCGACGTTGTTATCGCCAACAGTAGTAAAAAGCGCATGCGGGCGGCGCCACCCACCA
CAgtccacgttgaagatgcGGTATTGCGCGGAGAAGTTATGAAGGACGGCTTGTGCTGCGTGGAAACCGAAAACCATGAGGTCACTGCTGCTATTGCCAT
CAACAGTAGTCGGTGGACTCCACCAGATTTTTTTGATAGTAGATATGCCCCGAATGGACTCACGTCCTACTTGTGTGACTGTCAGTGTCCCTTGAGCGTC
TTCGTCGAGAGCAAACGAGCAAATATATCCGTCGTGACCACCAGAAAGCAGTGTGATATGATTACTGCCAGCACCGTGACTTTCAGTTTTTTCGGAGAGC
AGCAAAGTTGCCACAAGCTCACGCCCGTGGACTTTCAGCACATCAGATGGAGCTTGAGCGTTTGCGGATATGTCTTCGTTACCCTCCTGCACAAGCGAGC
GGTGGAAGATATACACACTACCATGACCATCACCCCCAATGATATTTCTCGTCAATGCTGACCGGTCTACGACCAAGATTGAAGCTATCGAGCTCTTGGC
AGGAATCTTGAATACGCCCACAAGTTGCATCGTAATAACAGGCGATGCCATGCTCTCACTTGCTTCTGTAATAGTCGGCTTCCACTCGTAGAGGACACCG
CTCGCACTACTCGTAAACAGAGCATCGTCCTGATCCCACCATATTTTCATAATCCGAACATTTGCTTGAGCTGTACATGAGTACAGCAATGCGCCAGTGG
TGACCTCAACGATGCACACACGACCTGTGACGTATCCAAGTAGCAAGAATCGACCAGACGAATCGATTGTAAACGTTGACAAACCGCCACTTCGGCCTTG
GGGGGAAGCACTGTCAATCACAGGAGTTGTAAAGAATGGTTCTGCTGCTAGGGACACCAGGTCCAGACGGAAAATATCACCGTGCTCAGAAGCCACAAAA
GCCGTATTGCCATCGTCTAGTGGGTTGAGCACGATGTTACGCACGCTGTGAGATgacatcatcttcttcgtcgatgCTGAAGCGGCTGCCGCGATAGGAA
CCATAATTGATTCGCACCAGTCTTTCACTCCAGGCACACCAGAAGAGGACATGAGTTGGCGTGGGATATCCCATAGTTTTGCGGCGCCATCGCCACCTCC
AGTAGCAATTAATCTGAGCGACGGGTGGACTGCTGTACGCCACACGTTCCTACCCATGTGTCCCTGTAATGTAGCAACGCATTTGCCGTCATGGTCCCAA
AGTTTGCACAAACCATCCTcacttgctgttgccacGCCATACTCCCAGAAAGACACGTCCCAAATGCGAGCCGAGTGGCCCCAGGCTCGGAACACAGGAC
TGTACTTGCTTGACAGAAGCACTTCACGGCTTGATATCCGTGGTAAGTGCAATTGTTCGACTGCAGTTTTCCCGTTGTTGGACCATAGCTGTACAGTACG
GTCGTCCGAGACTGAAGCCAGCGACTGCGCATCTGACGACCACGCCAACTTAAAGAGCACACCATCGTGGGCATGCAGTCGCTGTGCTGGCGCTACAGCA
AAGTCCGCCCCAACATCTCCTTCCACCATTGGGTCCCACAGCAAaatttgctggaaaacgGTGCCAGAAGCCACTACGAGTGTGTCCTGCGACCGCCCGT
GGAAAGCGAGAGCGTACAGAATGCACCGATCGGCACACTGCACACTACGCAAGATCTCATTGCTCACTGAGTTCCAGATCTGCACCAAGTTGTGTGCAAG
CCCAACTGCAGCCAACAGCTTATTAGACTCCCCCCCTTCCTCCGATGCACAGTCGTCTGACAGCAATTGCACGTCGAACACCCAATCGCAAAACACTTTT
GATTTGCCCAGTATCGtgagctcttccagtccCTGGGCCTCCTCTGGACTCTGTGGTAAATTCTGGAAACATGACACTCGCTTCTGACCGAAGAAAGCAC
CCACATAACCTTCAATTCCTGGAGTACTGGAGCCATGAAGTCGAACGACGTCGCAACCGTGTAGAATGCCTCGTGTCAATATTTGATGCTCGCCTAGGAG
ATCTCCAGAGGCGGTATTGTACAAGAAGATGGTGGGACCAACACCCACGTACAGTAGAGATCCATCAACAGAGAAAGATACCAATGTCACCGCCCCTAAG
AactcctgcttcttgattGGGTGTGCCATGACCTCTGCAGAT