Description :
From Genome Similarity Track
Location :
Scaffold_24:1008- 6450
Sequence
5442 bases(100 bases per row)
GGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAT
GCCACATATGGACTAGCTTTCGAACATATCCTTCCTTGACATCGGTCTAGATATAGCCAAACTCGCGACCCGCGATCGATATGCAATAAATCTCGATCTT
CATTATGTCGATCGGCTCGACCTCTGATCGCAACCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACCATATCTCCATCT
TCGGGCATCTCGATCCCGGGGTTTTGTCTTCCGAACGGCAAGGTTGCTTCCAAGGTCGATCTTCGGTCCCAATCGTGAATCAGGTAGAACGATGTATCTC
CTCGAATTCGATCATGAGCGGTGTTGATCGCATAAATCGATCGCTCTACGTATTCGTCCCAGTCCTTTTGATTTTCATCCATGAGATACATCTTGATCGA
TCGAGTCAGCGTCTGCACCGTGCGTTCGGCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGTCTTGTTGTTTTTGTCCCGCGATCCGATTGAATGCT
CGGAAGAAATCAGACATAAATCCCGGCTCGCGATTATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTACTCGTAATTCTCTGCGATCG
TCTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCCAAGAACAAATCGACCCACAGCAACATCTCGGTGTTTCCTTTAAAGGATCTTGGCAA
CAAAGGGATGTGACCCATAGCTATAATCTGAAAAGGTTACGTCGATTACATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCA
CAATTTACACAATCTCCCACATACCGCTGCACACTTCGGTACAACCCACGCCAACGGAATTCTACCTGATCCGTTGATAGGTAAGGCCGATTCCTTGGTG
ACCTCCCCCCAAAGTTGTGCGGTAGTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGATCCAGTTTAGTACGATCTTCAGCTTCGGTG
GCCGATCTCTGACAGAAGAATAGCAGCCCACTTTGGTCTACTTCATAGTCCGGTGCAATCAGGGTGCATACCTTAGCTTCAGCTACCGATAATTTAGCTA
CGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTCAATACGACCAATCCGTATCTGCTGCACAACCTCTTCATG
TAAAACCCTGGGCTGACATCGTCCTCTCTGGGCTGTTCGAGTGATAGCCGCTTCTTTGACTGCACGATCAACTCGTTCCGGTAGTAGTAATTCGTTTAAC
CGATTGAGAGTAATCAGGTCCTGACGCTCTTGATCGGAAACCACAACTGTCCCTTTCTCTTGCCGTAGAGATTCACTCGCCAATAGATCTGCACTCTGAT
TCCAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAAAAACTGCAGTCCTGGCGCTTTACAGTC
GGTTTCACCTCGCATTTGACGGATCACCAAATTCGAAACTCCGCAGATAACCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAGC
CCTCTGTATTCTGCTTCATTCACAGTTAGATCAGGGGTATACTCGGAAGCAGCAGCCACAATCATCCATTCCGGCAGTTTCCATATAATCGCGCTGTATG
CTCCGCCCTTTCTTTTCACCGTGGCTGATCCACCGAACTGGCTACCAGTAGGCTTTCATTCACACCTACTGTGGGTGGTGGCATGCTTATCTTCTGTCTT
GGCTGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCTAGTATTTCATCTTCTCCCTTCT
CATATCGCCTAGTTTCCAACGTCCAGTTCGATAGTAAAGCAGCCCATCTTCCCAATCTTCCGTTGAGGCCTGAAGATTGTAGTAACCATGCTAGTGTTGA
ATATCACGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAGCAGATATCTAGCATCCGGAGAAGAGCCAACACTTCTTTCTCCACCATCCCGTAG
TTGACCTCGTTGGGACTTAGCGTACGATTGGAGAAAGTGACAGGCCAATACACACCATCATAATCCTGAAGCAAAGCGCTGATACAGCCCACTTACTAGC
ATACACCACGATCACAGGCGATCGATCGGGATCGAAATACTCTAAGATTGGAGTTGTGGCTATCTTAGCTTTTAGCAACGTGAATGCAATCATTGCCTTC
TCCCATCAATTCCTGCCCTCGAAATCGCGATCGTCCCCTGCAATTGGGTACCGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATTGCCCCCTG
CACCTTCTTCGTGAATAACATCAGGTCTTACAGGAGAAGTAGGATTTGGAGCTTCACACGCGGTTGATCTCATGGAAATCTGCTTCGCGCAGTTCGTACA
ACACTGATGCGTAAACTGCGAAGTCTTCAGTGAATATACTGTAATAGTTGAGGCTTCTCAAAAATGGCTGCATCTCTCGCAGCGTCCGAGGGAACGGGAT
GTTCACCAACGATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCAAGGAGATTTGATGTCCCAGGTATTCCACCTTGCGACATCCCCAAAAACGTTTGG
CCAAACTGATCGACAAATTCCACTTATCGCGCACCTCCAATAATCTCTCCACTTTCTCATACAGGGCCTTCCAAGACGTAGCTGGTATTAATATGTCATC
AATATAAGACCTTCGACCCAACACCGATGGTTTCGGACCGGTATCTGGTTCACCGTCGGTGAAGACATCGATCAACTTTGGTGATCCGGCCGTGATCGAC
TCGGATCTTGCGCCTATTTTCAAATACCCATACAGATCGTTGTCAATCAACCGTTGGTAGACCTGTGGAGCGTTTTTCATCCCGAAAGGTATCCGTAACC
ACTCAAACTGCCCTGATGGTGTGATAAAGGCGGAAAACGCCC