Description :
From Genome Similarity Track
Location :
contig_42:100798- 102912
Transcript NameFunction/comments
g9036.t1hypothetical protein

Sequence
2114 bases(100 bases per row)
GAATTCATCATGTGGTAGCCGGATCGGGTATCCAGCTCTTGCTACTCGAACAGCTTCCATCACACCGTTGCAACGCAATTGGTTCAGCACACGCTCGCGC
TCGTAAATCCCTGCCTTGCACAGTTCGTTTGGCTTGAGGCATCGCACGTAGTGCGGGTTAGTCTGATGGAGCGTTTCCAGCAACGTCGTCAGCTGCTCCT
TAAACTGAAGACCGACACTTGCACCTCGGTGCTTACTGGTTTGCGCCCGCTGACGCGGAGAGGATTTGGCGCGGTCACGGGAACCTCCAATGCCCTCGCA
TAGTGTCCGCGCAAAACTGCCTTCTCGAGTGGAATACACGAGCATATCCACAGCCTCCTGGTGGAGAACATCCTTATTCTTCTCTAGGAACCCGTCCGAA
GAGTATTCTACGTGACCCGCATAGTGTACAATCGTAAATAGTCCACGCGCTCGCTGGATTCGGGATGCCTCGAAGCGCGCGTGGCTACCGCAAGCTCGGT
AGAGCTTCGATGCCAGCGTCGTGTCACTTCCTTTCGGCATAACACACTCCTCATCGATTAGCGAAAGGATACCTGTCGGCCGCTGCGAAATTAGGTTCAC
GCAGTCCTGGTTATCGCAGAACTCGATGTACTTCCAGTCCACGCCCTGGACTCATACTCGCGCTGCTCGGCCTTGAACACGTAGTCATTAAACTGCTGCT
GCAACGTCTCGTTTGCAAAGTTGATGCACAGCTGCTCAAAAGAGTTCTTCGGGAACACTTCGAAGCCGAAGATATCCAAGATGCCGATAAAGTGCAGGCC
GCCCTTCGCCTTCTGGCTGTCGTCCATCTTGAGAAAGTGGTTGATCTTCGTCACCATCCAGTCGAATAATCGGCCGTACAGCGCCTTCGCAAGAGCATCG
CGAGCGTTGTTGGCCTGAGCTGCGGAGAGCTTCATGCTAACAAAGTCGGTACCAGCACGAATTCGGCGTACACTCAGCGCTCGCTCCAGCTTGGTCGCAT
CCACAGCCATGAGCGTGGCTGCCGCATCGCGTGACCAGATGCAGCTCGAAGCCAAGTCCGACTTGCCAGCACCGGGGCCCATCGACTGACCCAACCTGTC
GCTGTTTTCATCGTGCTCAAAGGACAAATTGCCAATGTGCATGAGCGCCGCCAGGATGTCGAAAATACCTGCGCGCTCAGCCGGCGTAAAGCCCACGATG
TCCATGGCGTCCATAACTCGTCGGAACATGTCCGAGTCTTTGACGCCGTCCCGGCGCTGGTAGCACTCGCTCTGGTTCAGGTAGCGGTAGTGCAGGAACT
GCTGCGTGGCATCCGTGACTTCGCCGTGATCACCAGGAGGCATCGAGTGGCCACTGGGCGGGTCTAGGAACCAGCGCTTACGAGCCGCTGGGGCAGCTCC
GATGGCCATTTCGTAGAAAATGTGGTAGTTCCGCTCGCCCTTGGACTGCGACACGAGACGCACCTTCTCGAGCAAATACGTCTGGATGCTGGCGCCGGTG
AGTCTCCCGCCGCTGGTAAAATGCAGCTTGATAAACTTGCCGAAGCGACTGGAGTTGTCGTTGCGTAGTGTGCGCGCGTTGCCGAACGACTCGAGGAGGA
TGTTGGTCTGCAGCACTTTGGCCGCGATGCCCTCGGGGCTCTTGCCCGCCACGGACGCCGCCAGGTTGTTGGCGCCTACTTGGGCGAGATACTCCATGAG
GAACTTGGTGCTCTCGGTCTTGCCGCTGCCGCTCTCTCCACTCACGAGGATGCTCTGGTCGCTCATGACTCCGTTGAGGCCGAGCATCATGGCCTTGTAG
GCTTCTCCCGCGACTTGGTAGATGTGCGGGGGCATGGGCTCGCTGCCTTTGTTCCTGAGGGACGAGCTGCGCGCCTCGAAGGACAGCAGGTACTTGGCCA
TCGTGTCTTTACTGTAGATGTTGGGGATCTTCTGGAACGGGTTCACAGCCAGCAGGATGGCGCCCGTGTTGGTGTAGATCTTCTGCTGGGCGAAACGCGT
GTCCAAGGCGCTGAGGATCGACGTCTCGTCCAGCTCGATGAGCGTTGTGAGGTCGTCCACGTCCACATCCTGACCCTGAGAGAGCAACCGCACGTCGGGC
GCGTCCTGCGTCAC