Description :
From Genome Similarity Track
Location :
scaffold_6:1007515- 1008748
Sequence
1233 bases(100 bases per row)
CAATGCTTCCGCGAGCTACGGCATTTTCAGCAGCTACCCGCCGTATATAATTGCCCAACCCTCCTGAAGTAATCAGAATTTCCACGGGATGCCAAAGCGT
AAAACGTTCCTTTTAACAATCAGTACGTATGTGCTGTTAGTCATGCATCTCGTAAGACGGGTATCAATTCTTCAGGGCTTGGTATCATTAACTCCAACCC
TTATGAGATACAATATCTCTCCTTGGTAAAGCTCAAGCTATTTTAACTGGCGCGCTTGTAGATCTTCGAAGCGGAACCCCAACCAACGTCGGCATGAGAT
TTCTACATTTGAATGAACGaaaattacaccgctgaatgcatgtggatgattacggatgctgattacggacataatggCAGTCGCTCATCGTCTAGATAGA
TAAGTTTACAttaagaagcttctagaaggatctagaaagacAGGCTTNNNNNNNNNNGCAgtagtcccgagcgtgactcgcgggctgatcgtggagtggc
acgtaaccaaccgagcgctgctcaagttcatagcagtcgctgcatatcATGCGTGATATGGTCGGTCAAGGGCCGATGCGTCGAGAGCGAGGCCCCTGTG
ATgcatgtgaagtggcacgtaacccactgagcgctgctcgagtatcgaagcagtcgctgcatgNNNNNNNNNNGTTAATGTGagcgactaccattatgtc
cgtaatcagcatccgtaatcatccacatgcattcagcggtgtaattttAACAATGTACATTAAGCGCTTTACGTCCTTGCCATGGTACATATTCGACAAG
CGCGTCTACCTCGTCCAAACGAATTCTGGCCATGGTTCTCTAGAGGATAAGTATTATCTTAACCTTACcttttaaattttgaaatgtTACTATATATGTC
TGACTAGCAGACATTTCTGCTCGGGCTGTATACATGCGTTATTAGCTGTCGTCAGTACATGTCAGGCACTTGGTTGAGTCAACACTCGGAATGTGGTCTA
AGCATTGAGACACTTCGCACGCTGGGCTTTTTACATAAGTAGATAGATAATCGCTGAGTACCTATagaaatttttttcaatACAAAATATCACATATAAT
AGCTTAAGCTTTGCTCAATGAAACTAGACTATCTCGAGTCTCGCTTTTGTTGTTCTTTATAACATCTTTAGTAAGTTTTTCATGCACTAAGCGTACTGTC
CTCATTATACATTGAAGTGTTACGAACGTGAAA