Description :
From Genome Similarity Track
Location :
Scaffold_175:100741- 102296
Sequence
1555 bases(100 bases per row)
CGGGAGTCCGAAAACGGGAAGTCATCGAGCATTAGAGCACGTTATCAGGATAGAACCGGATCTCACCGAGCCAGAGAGCACGATACTACGGTAGCTAACA
ATCACACGGACGACAGACCAGCCGCGACACCACAAGCTAGCACGATAGCATGGGTTGTGCCACTAAGCCATGGGAGATCGCAGCCGCAGAGCTATAGACG
TAAAATCACAGTGCCGCGGAGAACGATACCAGTGTTGAACCCGAGCTTACCGAGCCACGGAGGACAGTACTACATTAGAACTAGATTGCACGAGCGGCGG
GCCACCCACGAAATAAACGGAGAGGTGGGCGCTTGGGGTGACCACGATTGCACACCACGGAGCACGAAGCCATTGTAGAGCACGATAATATACGGAAAAC
GCAGATGCACTGCGCGAGTACAATACATTAGACAGCATTACCACACCGGAGTTGCACGATAGCGTGATAACGTAGTCGATGGAACCTCGTCAGGAGAGCA
CGATACACGGGTGACGGAACAACACGACTGCGTGGAGGCACGAAACCACGGAATAGCACATTTTGGCAAGCGTACCGGCGATTGGAGGGCACCGGCCACG
AAAGACTACGTACCACGAAACCGGTGCAACCCACATAAACGTTTGAGAGCAGGAAATATGTAGCAGCCACATAAAACGCAATACTTAAGAGCATGAACCC
TAAAGAGAGAGCGCATAACCGCTGAGCAGCGTATTCCACGGGTGAGCGAGAACCACGAAACCGGGAAGAGCACGAAAGAGCATGGACCATTGCAGAACAT
GACATCCAGCCTGTAGTACGGGGTAGCGGAAACCTTCCAAGCCACGATATTATACGGGGCCGAATGAGACTACGGAAAAGCAAGTGGTTCAATACACGAT
GCCAAGATCTCCTAGGGTGAACGACGCTAACAAAGTACGTGACATTAAGAAGCACCTAAATTTGCGGCCACCGCATCTCCAACAAACCATGCCACTCCGC
CGCGTAGCGGCGGCGAACGGCTAGTCTTACCCCCCTATTAATAGTGGAGTCTGGTGTCCGTCTGTCCGTCCGAGGGTAGGGTTCTAAAATGTAACGCAAA
TGCGGGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCCTCGATTCGCTAAAATTGCAATATGTGGTGTACATATTATATGTGGTCTACACATCGTAC
TTAAAATGCACAGCTCAAATTTCATTTTGCCCCATTTTTAAAGCTGGAGCGCCACCTCACGCAAAGGGCGCTGCCTGTGCACGCGTTAATAAGCATTATT
AGGAGGCGCCGACGTGCACACACATACAATATCGTCGTAGGAGCTGGAGAAAAAATATATAGGCCCTGGTGACTTATATTTTGGCCTCAATCGAAACTTT
AGTACTTATTGAGTTTAGAATGATGTTTTAGGCTTCGTAGTACTGCTGTACTAATTTAACTTACAATATTATTTTTCTTAGTACTATTACCAAGGCATTT
CATATTTTTGCTTGCAGTCATTTGTAGTAGTAGTACACATAATAATTATATCAGC