Description :
From Genome Similarity Track
Location :
Scaffold_134:10072- 12785
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_134-snap-gene-0.10DNA primase

Sequence
2713 bases(100 bases per row)
CATACGCGACGTGAGCTGGATGCCATGGACGCGTTCCAAGAACTCGCTTACGATGAAGCTCTGGATACGCTGTCGCACTATGCGCTTCGACTAGCATTCT
GTAAGTACGTAAACATGCGAACGGATCTAAACGGCAATGCTGCGGATGCTATTTCTAACGGTGTGAGGTATTGCGCTTTGATGCTGTTACTGCTGGTAGG
AATAACGATTTGATGGAGTGGCTTGTCGATATTGAAGCCAAGTTGTTTGGCATTCGTCTATTTAATTCACCAAGGGATGCTGGAACCGCGACGAAGATAC
TTTCCCATGAAGGCATCAAGTATGAAACGACACGGATCAGCTCGCTCTCAGCGGCTGAGCGCCAGTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
AGATGCCGACCAAGCTGTGGTCTACAAAGTCCCGTTCGAAGAGGTCCCTCCGCTCGTAAAGCGCCGTCGAATACTCTTGAAAAGAGGCATTTGCTTAGTG
CCTGCTCGCGAAATGGGCTACGTCGCGTTGCATCATTTCAAAGTATTGCTGCTGCAGCAACTGAAGATCTTGCAGCGTGCGATTCCAGCGAACAGAGAAA
GCTCGTTGGAGCGTTTGGAGCCTATCTTAGAGCTATTTATCACAACCTCTCGAACTCAGAGCAGCCATGCATTGTCACAGCGAAGTGAGCACCCGAAGAT
CGTTGCCGAGAACATTGACAGCATGGCCGAGCGGCATTTCCCATTGTGCATGAAGAATCTGCATCGCAAGTTCCGCGAGAACCACCATCTCAAGTACGAC
GGGCGCCTCCAGTATCGAATGTTTCTCAAGGGCATGGGGTGGTCCGTGCATGACACCCTGCTGTTCTTCCGCAATGAGTTTGTCCGAGTCATCCCTGCCG
CCAAGTTTGAGCGCGAGTATGCGTATCACATCCGGCACAGCTACGGTCTCGAAGGCGCGCGGAAAGACTACGCGCCGTTTGATTGTCAGCAGATCATTCA
CGGAGCTGTGCCGCGGCATGGTCAGTACCATGGATGCCCATTTCGACACTGGGACACGAATCATCTGAACGCAGAACTGCGTCAGCACAGTGGCCTATCG
CTGTCAATAGCGTCGCAGATATCAATGCAAGCGGCCTCGGGCAACTATCGCGGCGCATGCCAGCAAGTGTTTGATGCTACCCATAGCTGCTCATACCCGG
ACGCCGTGGGAAGAAGTGAGTCGTCTCAGAGTGAGTCATATAAAGCAAGCACAGCAGCGTCAACAGCTACAACAAAGGCGAGTTCTGTTTACCACCCGAA
TATCTGGGTAGGTGCCAGTCTCCATAGCATTTGAACTGTGACTTTGAAGAAATAGCATCACTGGATACCGCTTTCTGTTAGTTATTGTTTAAGTGCCATA
GGTACTGTTTTTTGTTATCTACAAATAGTGTTAGGATTACAGGATCGGTCTAGTATTACATATTTAACCCACTTGCTCATGTGTGTTATTTTGGGTATTT
TCGGTTTTGGGTTGCCGCAACCAGTCAGCCGTTCACATCAAGTGGAAATGACAAAAAAGCAAAAAGTGGAGATGGCGGCGGACGCCGAGATGCTCGCGCG
CAGCGGCAGCGCAGGCGACGCAATCTCGACAGAAACAGACAGTGCTATGACTACAACTGCTGCTGCTGCTACCGCATCTGCGCCTGTGAACGTGGCTGCG
GTGCGCGACCTCGAAGCGCTCACGAGCGCCGTCGCGCACGTNNNNNNNNNNNNNNNNNNNNNNNACGCTGCTCGCAATCATCACGGAACTGCGCGCCACC
GCCGGAGTGAGTACGTGTGCGCGCTTCTAATGACCTACATTGTCCTTCTTTACGACTACGACTTGCATCTTATCTATTATGTGGATGTGCCTGCAGAGAC
CGTGAACAATGCGATCGCCAAGGTGATGCGGCCAAAGNNNNNNNNNNNNNNNNNNNNNNNNNAACCGGTGGACCCTGCTGTGCCGCCTCCACAGCACGGC
AAGATCAAAAAGAAGCGGCCCGAGAAGAAGAACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACGCGCTCGTGCGCACGAAGCTCATCGAGGACATCGAGCAGAGC
GCGTACAGCCGCTGCGGCCGCACGGACCGCGGCGTGAGCGCGTTTGGCCAGGTCATCGGCGTGACACTGCGCTCGAACNNNNNNNNNNNNNNGATTTCCG
CCAAGCTCGTGGACTTTGCAAGCATCGACGAAGTGCGTCCGGGCTCGAAGTTCCGCATCGAATTGCCCTCTGGCGAGATCAAGACGATCACGGAGGTCGA
CTACCCGACGCACATCAACCGCGCGCTGCCCGAGGACATCCGTGTGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCTGAAGAAGGACATGGACGTTGCGAAAATGCGCGAAGCAGCGCAGGCGCTCGTGGGCGTCCACGATTT
CCGCAACTTCTGCCGCATCGACACGAACTGCCACACGTTCGAGCGCTCAATCAAGTCGTTTGAGATCGTGGCATGCGAGACCGAGGTCGCGACGAACCCG
GCCGACCAGATNN