Description :
From Genome Similarity Track
Location :
Scaffold_910:10072- 11214
Sequence
1142 bases(100 bases per row)
GACGAGCTGATCCATTGGAATTCACATACAAACTCTGAGCTCAAATGTCGAATATGTAGTTGTCACGATTTGACACCTGAAATCAACCTCCGAGGTCCCA
CTTTCGTCCGATACAGTGCGTAGAAAAAGGACATCCACCTAGAATCGGTCCCACTCTCATCAAAGATAGTTTGACGATGTTCACATACAAATTTCACGTT
AAAATGAAGAAAGAGTTTTGAATATCTCATTCGAATCCGACACATCGCTCAAAAATCGTGCTCCGTTTTGACTTGGCTTTTCTATGGATGCTACCTGTTT
TATTTTGAGCTACAAAGTGGTTTCCGTTTTGTGGACGATAAATTGTGGAACTTTTCTGTCATTTGGCGACCACTTGGCTTCAAGTTGATGATTACTCGCC
AATCGGTTTGGACAAAGCTGCTGATGTTCGCTCAGCCAACTGATTGTGGCCCTGACACCTTTCGTTGGAAGTTGCACCTTGAATAGCACACCACGTCACC
TTGAGTTTACACCTGGAATCGCGCACCTCGAAGCTGTCGAGACCTCATGAGCAGAGGCTCATAGTATTTCTAAAATAGTACTATTTTAAAAGAACTATAG
TATTATACTTCCTTTGTCCCAGAATGTTTGCTGTGTTTCCATGTCTGGGGCATCAACTTTTGAAGTTCCAACCAAAATAGCATTCTGATGGCATATTTGA
ATAGCTTATGTCGCGACCTATTTTTGCAAATTTTTTTGACTTGGTTTGGATGAGCAAAAGCTTCGAAACACCAGCCAATAGATTTGATTGGCTGGAATGA
GTCTGCTCGTCGTGGGACTATGCTCTTGCAGTCACTTTCGCACATTCGCACAACATGTCTGAGCTCGTCGAGGAGGTGGCATGACTGACGATCGCCACGC
GCTATCGCAAGCTCAGCGCCGAGCAAAAGGCAGCCATGGTGATGGAGCTTCTCGTAGAGAGCACCAGCGGCGTGCTCCAACGTGGCACACTGAAATCTGC
GAGCGAGCGATGGATGTGCAGCGTGGACACAATTCGCTGAGTATGGAAGGCGTATGCAGCGCAGTCGGCAGGCAAGAGCGTCGGGTTCTCGACCAAGGCA
AGCAAGAGCGGACGGCCAGGGCCAAGCGCGACCGACATCGAG