Description :
From Genome Similarity Track
Location :
Scaffold_1030:1007- 4877
Transcript NameFunction/comments
Phyag_g9188hypothetical protein PHYSODRAFT_310535
Phyag_g9189hypothetical protein PHYSODRAFT_486841

Sequence
3870 bases(100 bases per row)
CACCATGAGAAAGCACAACCCGCCGCAGTCTCCGCTGCTCACTCCGCAGTCGGTGACGCCCGTTGTCACCGCTGGTTACAGCACCAAACTATGGGATGCA
AGGGCGCCGAAGTACTCCAAGAACGTGATGAAGCGGGTctgcatcttcctcttcgtcgtgaCGTTCTGCGAGGAACTGGCCGGATACGGCGTCAACCAGT
CGCTCAAGAACTTCTTCCAGAAGATCGGGTGGTCGAACAAAGGCTCCAACTCCATGAAACTCACCTACGATTCGCTGAGCCAGTTCGCGTGCATCGCTGC
CGCCTTCATCGCCGACCAGTATCTGGGCAAGTACAAGACGATGTTAGGAGCAGCGTCGTTCAGCTCGATCGGATTCGTGTTGATCGTCATCGCTGCCTTG
CCGTCTGTCCTCGAGAACCAGACCCTGAGCAAGGTGCTCTTCTGCGTTGGTGTCTTCCTCGGTATCGCGCTTAACCAAGTCGGCATTCGCGCGCTATTGA
TTTCCTTCGGGGGCGACCAGTTTTCACCCGCGTCGCCGCCAGAGCAGCGTGCGTCGTACTTCAGCATCAACTTCTGGGCATCGAATTTGGGAGTCGCCGT
CAACTACGCCCTGTTTCCTTATTTGTGCCTCTATGGCATCGGCGCTATCCCTGCGGACTACGGATACGTGACAGTCTTCGCTATCGGGTTGGCACTCATG
TTGTCCGTCATCGTGAACCTGTTGTCTACTCACTCTCGATACATCCATGTGCCGCCCACAAAGAGCGCGCTGGGAAGTGTAATCCATGTGGTTGTCCGCA
GTGCCAAAACCAACGTCAACGCGAAGATGATCGTCCTGGGTGCATTCCTATACGTCGCTGCCTTTCTGCTCAACATCATTGCAGCATTCATGtcggacga
cggcgaggtgGGTCATCGCATCTCGTACGTCTGCGGTGTACTGATCGTGGTCGCTACGGTCCTGTGGATTTCGTTCGGACAAGACACCTCGATGGTTGAC
GATGCGACCGACACTGACGGCAACGCGTTTGACCGCGAATTGATTCGTGGCGTGAAGCAAGTGCTCTACATCCTCCCgttcaacgccttcaacatGTTCT
GGTGGGTTTGTCAGAACCAACGTGGCAACAACCAAACGATCATCCAGCAAACGGATGTGCGCCTCGGGAGCGCCGTAGACTCGACGCAGATTCCTGCCCC
AACCGTGCAGTTTTTCAACCCGGGGCCTGGTTTGCTGCTTGTCCCGTTCTTCCACAACCTGGTCTACCCGCTGTACGAAAAGTTGATTGGCAAACGCCCA
AGCAGATACGGGATGGTCGCGGCAGGCTACGTCGTGGCAATCATCGCGATGGTCTGGACGGGCGTGTTCGAGATTATCCGTCGCAACTCGCCGCTTTTGA
CGTATGTGGATGCGAATGGGGAGACGCAGTACATCTTGAACAACAACGGCGGACAGCCGATGAGCGACATTCGATGGTACAACGCCATCCCCCAGTACGT
TCTTGTGGCTGCAGCCACCGTCCTCATCCAGATTCCGACGTACGATATCGGGTACAGCGAGGTTCCGATGGCGCTGCGAGGAGTGTCGATCGCTCTGGGA
CTCTTCATGACCTCGATGGGCAGCACACTATTGTCCGTGATTGTGTTGTTGTTTGGCAAGGACATCCCTGCCAACCTGAACGATGGTCACATGGAGTACA
TGTATTTCACGATTGCTGGTGTGATGACGATCAACGCCATCGCCTACGTGTACGTGATGAACAAGATGCAGTTCGCCATGATCCCTCGGTTGGTGAAGGA
TCCTATCGAcaacgaagagaaggagcagccGCCCTTTACTGATCGCCATAGTATTAACTGAAGTGGCAAGCAGAACTAGCAGAACTGCTATGGTAATCGA
AAAAAGCTTGATTATTCGGGATTGTTCAGTACTTCAAACCCTTATTAGTAGTGTGACTGTCGAAAGATATGTCGGGTCTCCAATTCCAAATCCCATAGGA
GCCAATGCGCAGCACACCACAAGGCATGCGTTGTGGTGTGCTGCGCATTGGCTCTTATATCAACCAGTTAGTGGGCTAGATTGGAGACTGTCAATTCCTA
GTAGGCAAAGCGCCTTTCGCTGGTAGGATGATCCTGCATTGCTTAGCATGGATGCATTCCCTAGCAACCCCGTTGGTGTCGGCCGACTTCGCTACTAAGT
GTATTCTATTGTGTATCGGTATTATTTCTCCACACGGTGTTGTGGCTGCCGCTCGCATTTTCTTCGCACCAACAGAGTAGATCAGCATTAAAGTTAAACC
ACACTTTGTTTTGTAGTGCTCACATTTACCGGTGCCAATATACATGTACCAAGGGTTATTGGATTCGCCACGCATCAATCGTGGACACTTGGATAGTGAA
GATGAGCAGCTCAACGAAATGGTCCACAATGTTTGACAATCACACAAGTCGCGCCTTGACTGGGCAAATGACGCGAACAACCACTGCTCACGCAACACAC
ACGTGTTGCCGGTTAAAACAATCACTGACCGCGACCGTGCACGTGGTTCAGGCGCGTCTAGATTCTCGCTCCCCACTTTCCAACTCGTTCTCAAGCATCA
TGGCCCCCCAAaacaacaacgacggcaCTACCCCTGCCACCAGTGCtgccgccacctcctcacCCACCCCCATCAAGAACGCTCTCAACCTTGAGGTCGA
GCACGCCCCTTTCACCCACCCCGAACTACTTGGTGAGTTCCCCACCGACACCTACGATCCGATCCCCGTGGTACCGTACGAGGACCGCGCGCTCAAGGCA
GACCCGACCTTCAAGAACCTACTGGCCGACGCGACGGTGACGCACTTGGAGCCGAAGATCGGCACGGAGATCTCGggtctgcagctgcacgagctgacGG
ACGCGCAGAAGGatgagttggcgctgctcatcGCGCAACGCGGAGTGGTGTTTCTCCGTGACCAGAAGCTCTCGATCGAGGAGCAGCTGGCTCTGGGTCG
CTACTATGGCCCTCTACAAGTACACCAAACGGTGGCTCACGCAAAGGGTATTCCCCAAGTGCACGTAGTTGAAAATACGGTGgaagcgagcgagaagaag
attgagACCCACCTTTACAGGCACTTTAACCAGTGGGTGTGGCATAGTGATGTGTCGTACGAACGCCAGGTACGTTGTGGCTCTTGCTAGAGTTTTTGCT
GCAATATCAACAGTGATTCTGTTGTGTGTAGCCGCCATCGTACACCAGTTTCAAGGTTTTGACTACGCCGCCCGCTGGTGGAGACACCGTGTGGGCTTCT
ACGTACGAGGCCTATGAACGCCACACCCCGCCGTTCAAAAGGTTTGTGGAGGGTCTCACTGCCATCCACAGTAGCAAGGTAATGGCTTGGTAACGCTAAG
AAATCTCGTAATTACGAGTACAATCTCACCGCCATTTTGTGAATGATACAGCTGCAGGCTGAGGCTACAATTGCTCAAGGGCACACCCTCCGGCGTCCAG
TCGTGGAATTCGAGCACCCGGTCGTTCGCACTCATCCAGTCACTGGGCGCAAGGCACTTTACGTGAACAGCGAGTTTACCACCCGCATCAAAAACTTGTC
GACTGCTGAATCAGGTAACGATAGACTGTCGAGTTGGAGCAGTTTGTGATGTAGTAACATGTGATGACTTGTGTTGGTAGACACGGTGCTGCGTTTCCTG
ACCGACCACATCGCGCAAGGACACGAGTTTCAAGTGCGCTACCACTGGACGAAGGACGCAGTCGCGATTTGGGACAACCGTGTGACGGCTCACTGCGCGA
CTTTCGACTATTTGCCAGGAAACCGGCACGCAGTTCGTGTGACATCCCGCGGCGAGGTCCCATACTTCGA