Description :
From Genome Similarity Track
Location :
scaffold_1018:1007- 2079
Transcript NameFunction/comments
g10834.t1hypothetical protein

Sequence
1072 bases(100 bases per row)
ACACGGCTGTCTTCCGACGTGGCGACCGCGTATTATTATCGACCACCGGAATTCAATCATCTGCAGTGACGAACTTGGGCGCAAACAAATTAGCACCAAG
ATTTATTGGTCCATTCAAGGTTATGCGAGCTCATGGAGACGCCTACACGCTAGACATACCAACGGCGATGCGCCTGCACCCGACTCCCATCCGCCGGTTC
GCGGGCGGGCTCGTAATCCGACATCCCGAGCCGCCGACGTTGGCAACGACTTGGTCCAAGGCCCACGCGCTCACACGCAGAGAGATTCCTCTGCGGCTGA
CCCATCACTGCCGTCTCTAGATTCCGAATCCTCCCCACCGAGCCGTGGTGTCCGCTCTGCGCGTTCCGAGCTGCCTTCATCGCGGCTCCCGCTTCCGCGC
GAGCGCTATCGGCTGCCTGAAGCGCATCCAACCCGTCGTCCCTCGCCTGCTGCGCCTCCGCCATCATCAAGCGATACTGTGCAATCGACACACGCTCCAG
CTGATACACCGGGAGTGCTTGACGAGGCGTCTTGTCAACATGCGAAACCGACGAAACCGACGCCCCTCCAGAGTGATGGCTCTGAAGCGTCGCGCCACGC
TCATGGTCCGCCCTTCCGTCGAGACGGTCCGCCCCCACTTGTAGACGCGCCGGGTGCTCGGTGCTGGGTTGTTGAGCGTATCGTTGACCATGATACGCGT
GCTCGCCGTGCCCCCGTTCGCCGTCCAAGAATGCGCGGGCGTCCGCCACTGAGAAGTATTATCGGGTCCGCTGGCTGGGATATTCGCCAGCGGAGGACAC
ATGGGAGCCCCGAAGCGCCCTGATGGAGGATATTCCCGACGTGGTAAGGGACTACGAAGCCTCGCTCGCACTGGCGACAACGTGCGAGGGCGTTCCGCCT
CACGGTTTTGATATTCACGCCGATCGCGACTACGCGAGTGCGCGCGAGGTGGAGCGCGGCGCGGACTTCGAGAACGTCCCCGACTACGTGAACGCGGGCG
CCCACGATAATGTCGCAAGCCTTCCGAGAGGTCGCGGAGCCCACATCCGCGACTGCGACTGCGACTACGACT