Description :
From Genome Similarity Track
Location :
Scaffold_58:100677- 106076
Transcript NameFunction/comments
Hyaar_Emoy2806995hypothetical protein
Hyaar_Emoy2806996hypothetical protein
Hyaar_Emoy2806997alpha-1,3-mannosyltransferase, putative
Hyaar_Emoy2806998alpha-1,3-mannosyltransferase, putative

Sequence
5399 bases(100 bases per row)
TGATGCTGCTCAATCTCCTTGTTACTTTAGGGACGTGACCGAGCATGGCGTGTCCATCTCGCAGCAGTATCCAGGCCACGTGCTGGGCACGATCTCCGTT
GTGGGCAATAAGGCGGGCACACACGCCGTGACGAGCTCTCTGGACTGCCAGATTCGCGTGCTTAATCTCTCGTCCGGGGCCGTTGAAAAAACGATTGATG
CTGGACCAGGGGAGCTCTGGCAGGTCGCCTACAGTCCGGACGAGACCAAGCTCGTATCAGGCAGTCAGCAGGGCAAAATCAACTTTTTTGACATCGAGAC
GGGGAAGATTGCACAGGAAATATCAACCCAAGCCAAGTTTGTGCTGAGTGTTGCTTATGTACGAGCTGGTCTTGGCTCCATGGCTATCAGCGGTGGCTTT
TTATGATGCTGAAAAATGGGTGATGATGATGGTGTTGTAGTCCCCGGACGGGAACCATGTCGCCTGCGGGGGCTTTGATGGTTTTGTTGGCGTGTACGAT
GTTGAGACGGGATCACTGGTTCACAAGTACGAAGGTATGTAGTACACGATATACATTACTAAACCATGGAATGCTGACGCATTGCTACTTGTAGACCGCA
CGAAGCCGGTGCGCTCGGTCGCGTACTCGCCGGACGGAAAGTTGTTCGTCGCTTCCGATGACATGCATGTTAACGTCTACGACGTGTACGTGATGGAGCT
TTTGTGTGGACCTTCAATGAGTTGGGATTTCAACCGAATAAGTTGTACTTACTATTGTTCAGTGCACATGACAACGCCGTTGCAACTCTATCTGGCCATG
TATCATGGGTGCTGAGTGTGGCGTGCTCGCCTGATGGGAAGCAGTTTGCTACAGGGTACGTTGCTGGTTACGACTAGGTACGCTGTTGGACATCACTAAT
AGATTTTTGGTTGCTCGTCTTGCTAACAGTGGCGCAGACCGTCGTGTAAAGATTTGGGATATTGGCACGAGGCGCTGCTTGACCACTTTCGAGACGCACA
CAGATCAGGTACGACGCAAAAATATCACTTTTGTGTCGCGTACTATTCGTGAGGCGAACTATATAATAACACTGTGGTTTGCTAGGTGTGGAGCGTTGCG
TACAACTCATCAGGGTCGCGATTGGTGTCGGGTGGTGATGATGCGCTGCTGCAAGTGTATGAGACTGCTGTTTCCGCTTAAGCTCATCCGCAAACTCGAG
GATTCATTGTTTCGCTAAAGAGCTATGTTGTTAAGCTCGAACCTGGTTGAATGAGTACACTAGGTGGTGCTTGAAACACGGTGATGTGAGAGCATTTGCT
AGCAACATCACTATTTTGGTTGGTATAATAGAGCTTGTAGCCAGCTGTGGTTCTCAAAATTGCCACGGTAGGCTGAAGGCATCGTTGATGTGACGCTTTC
GTCGGCTTTCGTGCATATTCAGACCGCACGCAGTGCTTGCTTTACTGCTGAGCAGCTCTGATACACTAGAGTTTGGATTCGAATGTCATTTATAGATCGA
TGTTAGCGGCACAGCGGTTCTACAATGGCCGACATTGAAACCTGTCCCATCATGATTTAAGATTTGGACCGCTTTTACGATGTCGTCGGCCTTGACAATC
TAAATGCAGCACTCCAACATGATGCAGATTGTGCAATACCCGACTCATCATCACCTACCAGGTCGTGTATTGCCACTCTTCTCTGCAATCGCCCCGCGAC
ATCACTGTTTCGTTGCATAACATCCCCCAGACTGTACCCCGTGTCGAAACAAGAGTCGAGCAATTTGCCAATAATCCATCTGCGGTAACGTAAGAATACT
GCGCAGACCCTTGCTCCAATTTTCGAGCTTCATAACGCATCGTTTCAATATGGGCGGCACAACTTGGAGGTACGGCAGATGAGATCAGATGCTCCTTCTA
CGGCCGTTGCACGGAAGTCCCTAGCTTAAAACTTTGACGATGCTCTCGAGCGTCGACGAGCCAAATTGCATCAACCTTGAGCAACAGCATGTCACCCTTG
CAGGCCTTCAAGCAAAGGCGAATCGCTGTATACCTTTTTGCTTCAAGCGATAGGATCCATCCTCCTAGCCAGTCCCGGGATCCGTCGTGAGTCGTGACTG
TCAACATCCGCACTTTACATGCTGTATCTTTTTATCAAAGGTGACACGACCTTCAGCCTGGACGTAAGCGCCAGCTGTTGCAGCTTGTCCTGACTGACTC
TCATGTAAGCCGGGTGCCCTGTTGGATCCTGAAATTATAATTGTAAGACAGGCGTGAAGCCGAGCCCACGTATTGCTTTTGCTGCAAATCGGTGTTCGCG
CATAGCAATGGCTTCTGGCTGACAAAGACCAATTTTCCAGTATGCAGAGACGGTCGATATCGGAGAAGTTGGTGAAATCGGAATATCGCCGTATTTTGCT
CGGCCCACAGATGCACTTGTCACTTCCCAATCGGCAGCCAGCTGCAACAACGGACAGAGACGAGACCCTCCGGGGAGCCAGGAAACTGGCCCCCTTGCCT
TGGGCGGGAAGTCCCCCGTAGTGGGGCCAAGGTAAAAATGGGGGAGGGTTTCTCCTCGCTGCGTGTGCTACGGGAGGCAGCGCAGCGTGCGGCTCAAGAG
AGAAGCGGTCCGCAGGATATCCCAGTGCAGGGCACGTCGACGCTGGATCGAATCACCCTGCAAAACGAAGAAGTTCCTACTCTTTGCGATCTGCCTACAA
CTCGCCGACAAGTTTGCTGAGCATGAGCCCGGTCCCACGAAGAGAACTCCCCCAAGACCGTGACGACCCCCGTTGAGATTCAGTACCGGTTGTTTATGTA
CAGGTACACCAAGCCAGATACTCTTCGTCCAGTGGTGCGTCTGGGCACATTTGAGCACGTTGTGAGCCCAAGCCGACCTGAAGAGCAAGAAGTCGACTAC
GAGGTGATGGCCAGGGATTACGTCAAGATGGCTCTCTGGGACTACCGCAGTGGTAACAGGACTCCTAGTTAAGCGTCCTCTGTCCCCTGAATCAAATTGC
TCCGAGCGCGAGAGCAGCTCCGCCATCCGGAAGAGTGCACACAAGAATCTAACCCCGGACTTGGTCAACGGACAGTTTCCACGGGCCCTTTTGGGAGTGC
CCCGCCGTGATGCCCGACGTCTTGAGCCAGCAGAATGAGATACCTAGGAGTAGTAAGTCTGTGTCATGGTAGATGACACGAGGTGGTTACCACACAACCA
GAAATCTTATTAGTGATAAGTAGCTACAATAGACAGTCTGAGCCTCTCACATATACACTCGGCATAGGAGCTGCACCCCATCACTGACACATGTCTTCTC
GATTGCCTAATCCGGTCATATCGTGTGTCATATCAAAGTTCATCTATCACTCAACTCCTATCATTGAAGTGTCAGTCAGTATTAAGACCTTTTGACGTCG
CGCTTGTCCCAAGCCTTCGCCACTCGCGACATGACGACGGCACCCCCACCCCCACCCCCACGTTGTGCGTCCTGTGGCGAGCAGCAGACGGGCGGAGTGC
GCGTCAAAGACAGCAGCAGCTGGTTCTACCACACGGTCTCAGCGGCCACGCCGACGGAAAAGCGCCGAGCCAATTTGTTCGATCAAGAGCCAGGCGAGCA
GAACAATGCACAAGACGAGAGCGACAGTTATGTGTGGAGTGTAAAATCGTCAGAGCCGATGCCTACGCGGGCGATCGCGGGCAATTTGCGGGACAATATT
TTGTCTCGACTGTCGACGCTCCGAGCGCTCTGGAGCGAGGGGTACATTACCGAGGACGAGTACGAGCGGTCAGTGGCTGTCTCGTTCAGTTTGTTAAGCA
ATTCCATCTCTTATTTTATTTTATGCTGTAATAAGGGAGTGTGATTGACCTGTGTGGTGTGAGTGGCTTTAATTTGATTGTGTAGACGAAAAGGAGCTAT
TGTAGATGAACTCACATTCTCGACGCTCGCTCCAGCGTCAGGTTTCCAGCACACGGTCACGCACAGAAGACGAATGTCGTTTCGACGAATGGAAAGTACG
CACGCAGAACCTTTTGTAGCTGGCTGCCGCTCGGTAGCTACTATCTGCTCGGGTTATGAGATGAGGAACGGGAGGAACAAAACAATAGGCTTGACCGTTT
TTGTTGTTGTTGCTTGTATCTTGCACAGGGTTGCCACTGATCGTGCCACATGCTCCTGATTTTCGTGATGTCAGCCCCGAGGTGGCTGTGAAGCACGTGT
TTGAATATGCCACGCGCCAGTGGAACAGCACGCAAGTGCTTATTTATCTGGACGAAACACCCTTTTGCAAGGGAAGTCTGCGGATTGTGTACCACTTGCA
AGATCTGAGCATGAAGAGCCCCGGTAGCTTGCTCACTAGTAGCCAGTACCCAAACAGCTATGTGGCTAAATTGGCCATCGATCCGGACGAAGACCCGCAG
ACCTACTTTAAGGATATCGAACTGCAGGCTCATTGTGCACACTATGCTCAAGTGTACAACTCGTATACACCGCCAAAATGTGTCGAGTTCATTCCAGCGT
GGGTGTTAGAACTACCCGAGCGAAATGGTGCATTGTGCGCGGTTGAGGCCTACATCCCTGGCGAGTACCGCAAACACAATAACAATTTTGGATCCGTGAG
TGATGACGAGCGCAACACACCACAGGCATTTTCTCACTTCACGTATGAAGCCTCGAATCATGAATTGCTCGCTGTGGATATTCAAGGCGTAGGCGATTTG
TACACGGACCCACAGATCCATACGCTGAATGGGCAAGACTTTGGGAAGGGTAACCTCGGAATTTTGGGTTTCCAGAAGTTCCTCTCATCGCATCGCTGCA
ACTCAATATGTCGCTATCTCAAGCTTCCAGCAGTGAATCCAAAGTCGCGTCACGCTGACTCCGGCACGTTGCCCGTTCAGGAGCTGATGAGCCGTGATCG
CGTAAGACCCGCACACTTCGACTCACGACACTATTACGAGAATGCACCCATGCTGCAAAAGTACGTGACGCAGTGCCGCGAAGTCGACAGCCAGTCGTCT
CTTGCATCGTCTTCGAGTTACTCCAGGCGACCACGCAAGCAACGCTGTCGAGAGGTGTCTGGATTTGCCCTCTTTTGTAAAAGGCTGTTGTGCGGAGGCT
GGTGACAATATATACACACGCCTTCGCAAACGCTGATTGAGGCATCACCAAATTTACAGACTCTCCTCTTACATGAGCAAAAGCTCTGGAAAAGACAGAA
CACATATCATCACTTATGTGTTAATGGTGCGTAAAGCTTTCCATATTTATGCTACCTTCTCACCATACACCGCCTGATGTACCAGCTCAAGCAGAGTGTC
ACCGAAAGTTTCGAGTGAAAAAAGCTTCAAAGCACGTTGTCTACCGTTAGCACCCATCTCGCCAACTCTGGTGCTGTGTTTATGCCCACATAGCTCTGC