Description :
From Genome Similarity Track
Location :
Scaffold_158:100664- 102280
Transcript NameFunction/comments
Hyaar_Emoy2811474vacuolar protein sorting-associated protein, putative

Sequence
1616 bases(100 bases per row)
CGTCCAGCTCTGTCCTGCATCAGTCTGTGCATTATTCTGCTCGTTGAACTCCGTCGCCTTCTCTACAGCGTCAATAGCCGCACGTTTGCGCTGCAAGTTC
TGCTGCTTCTTCCTCGCCGCGCGTCGCTGCTCTTCTGGCGTCAGTGCCACAGCGTCAGACGCCGCGCGGTCGTCCGTGCAAACCTCAAGAAGTAGACTCA
CGTCCTCGATATCCACACGAATGGGTTGACCCGCCAAGTTCGTCCACGGGAGGTCGATACGGAGCTGCCGAAGAGTCCCTTTGACTAGTCGCATCTGCTT
TGGCAGTGGAAACGCATCCGGCTGGAGCTCCACGGTCTCGACCTCGATCTTGCCGTTCCATACGCTTATCTGGAGAGCTTTTGGGTCAATGTTCTTGACG
TAGCTGCCTAGCACAGCGTCTAGGACCACGTGCACGTAGCGCTGGAGGAACATGGCGGAGTCGCCGCCCCCGTTTGCGTCCGAAAGATTGATGATGCACT
TCAACAGATCGGATGGATGTTAAAACATCGAGTTGTTTCGTAGGTTTATTCTGCTTTTCGTTTTAACAGTAGTCGGACGGTGGGATAAAGTGCGGCGATT
ATTGCGTTGCGAAGACTTGACGAAACGCAATGCTTGATACTACAACTAGTAGCTGTCTGTGATACGAGGATTTGTACAGCAATGATTGCAGGAAATGGAT
ATAGAAACACACCAGATTAATTTTCTACAAATTGTCGGAAGGCCTAATTGTACTCGATTTCATGTAAATTGGTCAAGGCGTCTGGGCGATTGAGTGTAGA
CAGGTGCTTGTGCGTATTACTAGTAATACTACTGTTGCTGAAATAACTAATGTTGTAATCGATACTACTATGATTACTACTACTACTACTTTTCAACATC
ATTACTAATAATAGAGCTACAATTAGTACTACTACTACTAGTATTTCCCAACATTTTAAGATAGAGAAGCGCGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGTGCATCACAATATTGACCTAGCGATAGAGTGACACCTATCTTGATAATCGACCTATGAGGGGGGGGGCAGGCTAGATCGTA
TTTAGTACAGGTAAGGTACACCTAACTGCGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN