Description :
From Genome Similarity Track
Location :
Scaffold_1046:10065- 14879
Sequence
4814 bases(100 bases per row)
CCAGTGAACCGTTGGGCATATACTCCATGACGAGTGCGTAGCAGCTCTGTATGAGACTTGCTCCGAGCAACTTGTACCGTTCGCGCTGGCATGCTCATGT
TTCGCGGGTGTTTTCACTTTTATATTTTCTGCTAGCGCTATCGTGGCTAACTCCCGCCCACCTCAGTTCAACGGTAAAACATCAGAAAAGGAGCGAACCA
TCTCTTTGGAAAGTGCCTGGagcttttcttcttcttccagcgcttctTGTGGTGACTTTGCCCATTCGATTAGCTCTTTTGTAAAAGTGGACATCGTGAT
AAATGCTTCACGGGAGACAACGCGGGAAACTAGTAGATATGGTTGCTGTGGTTTGTTCACGGCGGCTAGTTTTGATTTCCACTCCACTGCAACTGTTGTC
TGCAGAGTTTCGCCTTGGATCTTATAGACCGTTGCGCACACGAATGGGAACTGCTGAGTTATTGTACTAACACAGCGCTTTGAGCCATCTGGTGCCATTG
GCAGTGAAATTAAGACCTTCTTGTAAGCTTCAGCAGTAGGAAATACGGGGAAAAGCTGGGGGTCGCCCGTGCTGTATAGGAATTGTCTGGTGGCCTCGGT
ATAGGCGCAGTAGTTCAAATAATGGTCGTTTAGATGGGACTTGGACAATTGCGCCTGAGCGACTGTCCCGAGTAAGCTAGAATTTCGTGTCTCGATCAAA
TTGCACGTACTCTGATGTGCCCAAGCTCCCATTTGCCGCCCCTTTGGCAGGGCGCACGTTTTGAGTCATCTGGATCGGCATTCCTAGTATCAAGTGGAGA
AAGGGGGCCATACGGCCGAATTTTGAATGGGTAGACCCATTACTAGCTCTTTATCGGGCCGACTTAATCCGGAGAGAGCGCCTTTGAAATTTGCCGTGAT
ACGTAATGGATATTGATCTGTGGGAAGCATCTCGGCTCTCTTCTGACAAAACAGCGAATTCACAGCAGCGCGCGTAGTATTCACCGGCGTCACAAAAACC
GCTTCTCTCATGTCAAATGTATCGATACCCACCAGTCAATTGTTCGTGAACTTGTCAATGCGATGAAGGATGGCGTCCAGTTTCCTAAACGTGCTTGCTC
GCATCCTTCACCCCACTCGGGGTCTTTCCGAAAACGTACGGACTCAACCAGAATTACCGCCCTATCAAATCGTCTCCACAGTTGAAACGGTTCATTGTCG
ATCGTAGACACTCGGCTCTTACGACGAGGATCTAGGTAAAGAGGGTCTGCTCCCACCGGGGGCAACTGAAGAAAATCTcctacgacgacgacatggatCC
CTCCAAAGGGAGCACTGCTAACGCGCTTAAAGCGCCTCAACAATTTATGGAGCTGTAGCCATTCAGCCTTCATCAACGTAGATACCTCGTCAATGACAAG
AATATCGATCGCCATCCAGTCGGCTCCATCTGCTCTCTTTTTTAAGCTTAACATGAAGCTGGCAAGCGTCCTTCCACCTATAAGCGTTGCTGCTTTGCCT
GTCAGGGCTGTTTTCGTCAAACATGACCCGCACCCCCACCAAGTGCACAAGCTCGCCACCGCTTCGATCAAACGGCTTTTTCCCGTTCCCCTTGGACCTC
CATGAAATAGACGTAACTGGTCGTTTAGGAGCGTGTTTTCAAACGCATTCGTTGATGGATGTTCATTCTTATTCTCCTCCATTCCTTTCCAGCGCGTCAA
CATAGCATTTCCTATAGTGCAAAATGCTGTGTGCTGAAGACGGTTCAATGTGTAAGCCCGCAATACAGTACTAACTGACGCATAGCGCTGTATTTCATCT
CGGTGGTCAGCATTCGGAGTAATGTAGGTCCAGCACATGTTTTCTTCCAGTAATGCAttgttgagcagctcaatcACTTTTGTTTGTTCATCATGGTCGG
CAGGTCGGGTAGATTCGTTTAGCGCGTTATCTGTTTCCAGGTTATTCACCCATTTCTGCAACGTTTTCGGCGTGACAGGTAACTCCGAGGCTTCTAATTC
TGTGTCGTTAATGCCGTAATGTGTCTGATTTTGTAAGGCCGCGACGCTACTGGCTGTATAGTGGCTCTTGGAGAAAGCATGTCAAGAGCAGCGAAGCTCT
TCAAAATATATTTCACGTGGCTATCCGGGACAGAGGTGCTGGGATAATGCACAGGATTCATGACGCAAATGTCAAACACGGTGTCGTCGCTAGCGCCACT
CCATTTATCTAATAATTCGTCACCTCGATATATTGCGTCCGAGAAAGAATCCATCGATCCATCACTTTCATTATCACTCTCGCCCTGATCGCTGTCGGTC
GATTCAtcatcgtcgccttcttcgtgtcCGTTCTCGTTTGATCGCCCCTTGAAATAATCATCCATATTGCTCATAGTTGTCCGTACGAAAGCGCTTCGCT
GTGTCTCCCATTTCATATATGCACTGTTCTAGTCATTATCGCTACATTGCTCGCCGTCTAATAAATCGTACAGAGGTCGAAACGGTTTAAATAGTGTTAA
CGCAATTCGTGACCGTTTGGCTCGTGCATCATCAGACATGCTCTCATCCACCAACGGCATACGTGGCCCGCTTACACTAGGGACCACTTCCTTCCTTCGT
GATCCAATTCGATGATTGCCGAATAAAGGGTGCCCTTGCTGGAAACATGAATCTTATCCTGTGGTTTTGGTCTTCGCTGTTCGGAAACGCTTTACCCAAA
ACTCGTAAACACTCAAAGCCTCCAGCCCGGACGGTCGAAATATATAGTCGTCAAGAGATGATGCTGCTTGGATTGTGCGCTTGCAGTCAGTACTGACAGA
TTCGCCGCTAACTAAAGTGCAGCGGTGCGGGTCTTTCTCCAGCTGTTTTATTATACTATCCAGAGGTAAACCGACGCATGTTGAACTGGAATAACATCAC
GAGCTTCGCAATAGATATAGCGTGGCGGGGGGCCCGGCCACTTCTTGGCGATTCGTCAGGTGGTACGCTATTGAAGCCACGCGTTTTCGGGATTGTTGTG
CCTGCCAGCTGGATGTTTCATCAGCCTCTTTTTCTTTGCGCCGCCTCAACGCGGCCagcgcgactgctgctgaagaatCCACTTGGCATTGAGCCTTTAT
TACGTACTTACAACAGTAGTAAATTCTATCAGTTACCCCTTCACCGCCGAGGAGGACTTGGATGTCGTGATTCGACTTAAATGTTGCCAANCGTGATTCG
ACTTAAATGTTGCCATAATAACGTCGTTGTATCCGTTTACAAACTCACGAGCCACTTTACGGCATAGGCGTATCCCCATACGGTGAAAGTTGGTCCGGGC
AACACGTTCGCGGGGAAACATATATCGGCACAGACATTTGGATTTGGTTGCCCCAGACTTGTTGAAGCAGCTCCCAGCATGAGCCCACCAGTGAACATTC
AGCAGTACAACCAGAGTTGAGACCATAAACTTGATCGACGCGTCTGACATCCGCAAATCATCTGGTGATGCGGGTGATAATTGATTTGTGCGTGTTACAA
CATCTTCACGAAATGGGTCGTCGTCACGCCGTAGATAGCTTCCCTCTGGTGACCTAAGCAGGCCAGGTAGTCGTGGTAAACTTGGCTCTCCTCATTATTT
TCAAAGCTATCGCGGGTATCAAAAGCAGCACTTTCCACGGAAAAACGATCGCATAATTATCTGAAGTACTCTCTGATCCACAACACTTTTTGCCTCGATA
AAATATGTTCTCCAAAACGCCTCAAGCAAGGCTTGCTCATGAATTTCACGAGCGGTTAAAAGTTTCAACGGTGGTGGCCACGTTCGCGGACGTGCTTGCG
CTAATACATGTTTCATCACGAGTTGAGAGCTCATTGCCGTTTTGCAAATTCCACATCTTACCAATAAAGGTTCTTTGATTTTGGCTCGTTCTGCGGCACT
GCACTTAAACCACACGCCCGCCTTAGCCTCAACAGGAAGCTCTTCGAGATGTTGATATCGCTGCCCGCAAACCGAACACACATAATTATCGACAGGTAGA
GCCAATTCGTTGGTAACTATACTATCCGTATAGTCTTCGATTGTTGTTTGGATGGTTGTTTCTTCACCTTGCGTGCGCAGCGCTCTCTCGAAAACTTCAC
TGTTGGGATAACAATCGTTTAGCCATACCAAGAAGTGAACGTACAAAGTTCCGCCGCCTTGAGTCTCAACCATCCCGAAATATGCCTTCACCGACCCAAA
TAAGCCTTCCGCGCGGCTGATTCGAGCACCTTTGTCATGGATACCAAGCGCGGGTGTCGCAAACGCTTCGATGTATCGTGTAAAAAGAAGTGCCGATGCC
ACATCATTTTTAAAACTAGCTTGTCGCAATTGAGACCTTGAAGGAAGTTTCTCCATTGACCAGTCAAACAAACTTTCAACACTGCTCAGACCACTGTAAT
GCGCCATTGCGGATGACGCTGCCACAGTTGGTGTCAAAGTAATGAATAGTGCTGGTTGTCCACATCGAGCTTGATACGCGAAAGCGTCTTTTTGGTATCT
TCGCCTTTCAAGGTTTTTCCCCACAATGCCCCTGTTCTGAGCTCCACAGTCTTTAAGAAACTTGCCGCGTCTGTACCCCCCCTCCCCTCCCTCACAGGTC
CTAGTCGTCCTTGAATGCGTCCTTCGTTTTCACCAACCGCCTTGCTCAGTTGTTCAGGGGTGATTTTATCATAGCCCTAAAAAATGTATGGGCGGCGCTT
ACATTTCAGAGCCAGCTGCAGGAACATGTTTTGTACAGATAGCCGATCAAAAGCTACCAGTACAAACAATGGGTCTTCAGCAAATCGGCGCGAGCTCGGA
TTGCAGTAGTGCTT