Description :
From Genome Similarity Track
Location :
Scaffold_632:10062- 13509
Sequence
3447 bases(100 bases per row)
AAGAAGCTGCGCGTGCTCTGTCTGCATGGCTTCCGCACGAACGTGGAGGTGATGCAGACGCAGACGCAGGGACTACGCGACGCACTGGGCGACAACGCCG
AGTTTGTATTCATCAACGCGCCGTTCCCGTCGCGTGGGGATACGGACGAGGTGATCAAGAAGAAGTACGGCGCCGACACGGTCTTCTACGAGTGGTGGCA
GGTGCGGTACCTGGAGAAAGAGGAGATCGCGGACCTGTCGGCACAGCCCAACCCAGCGGAGACCGAGGACACGTGGAACCTCGTGTTTGAAGACATCGAC
GTCGCGCTCGAGTACATGGACGAGCAGATCCAGAAGCATGGGCCGTTCGACATCGCGCTCGGCTTTTCGCAGGGGGCGATCATGTGCACGATCCTATCGA
TGCTCTACCTGCAGAAGCAGAACGTGCGGCCCTGGAAGATGTGCATCTGCGTCTGCGGCGTGCGCGTGCACGGCATTAACGTCCGTGAGCTCTTCGAGAC
CGACGAGGGCGAGCAGGTGCCCGTGCCGTACCCGTCGATCCACATCCTCGGCAAGCTCGACACGCTCTACGATGAGTCGCTGGCGCTCTCCGAGATGTAC
GCGAACCACCCAAAAGGCTCACCGATGAGCAAACTCATTCTCGAGACCGAAAGCGGCCACAAGTTCCCCACGCCTAGCCGCCACAAGCAACTGTACCAGG
ACCTCGCGCGTACGATCCTGCAGTTCTTCGAAGACACGACCAAGAGCTCCGTCGCACGACTATAAAGTAGTGACTGCAGAGCAAAAACACACCACCATTA
TCAACAGGATCTTACACACACACACACACACACACACACACATGCACACACATTAATACATAGACAGCTCACTCCCATCGTGAACATTTCGATTACCACA
TGATAGAGCTCTTGGACCTGTTCTGTGGTCGCTTTCATTCAAGGATGACGGCATGGGAAAACGGCACTCTTCTGCCATAATCCGTCACTAAAGCGGGGAT
CACTTCCTTCTTCCCACAGTATGATTGGGTATAATCACGCAGAAAGGCATGTTTCTCACCAATCGCACGCAAAACTGTTGACGTCAACGGAGAATCCGAC
GTTAAAAAGCCTCAGGTTGAAGCTGGGACGAGCAATGACGAATGCGCCTGCGCCATCCTGATGACATGCTGCTTGTGTGTGTGCATGTGGCTACCCGCCC
ACGCTAGGCCATCAGCAACAGCATTGTTAGTATCGATTGAGCTACAACAGCCATGGCATCTACACCGGCGACCTTGCTGTCCTCCTCCCCCACGAAGAAG
CTGCGCGTACTCTGTCTGCACGGCTTCCGCACGAACGTGGAGGTGATGCNNNNNNNNNNACAGACCCGCGGGTTGCGCGAGGCGCTTGGCGAAAACGCCG
AGTTCGTGTTCCTCAACGGTCCCTTCGAAGCCGAAGGTGACTCGGACCCGATGATCGAAGAGCGCTACGCAGAGAGCGCGCCGTTCTACGAGTGGTGGCG
ACTGCACCAGCTGGACGGCGAGATCGCGGATATCAACTCGTCCGAGTCGTCGGCGCGCGCACGGGAGACCGTGGACGACGACAACATCTGGTACATGCAC
TACGGACGGCTGGAGGAGACGCTCGCGTACATGGACGAGCAGCTGCACCGACTTGGCCCGTTCGACGTCGTGGTCGGCTTCTCGCAAGGCTCCGTGCTAC
TCACGGTGCTCACGATGTGGTACTTGCAGCACCAGAACAAGCGCTGGTGGAAGCTCGTGATCTGCGTCTGCGGCGTGCGTGTGGGCGCCGTGAACTGTCG
CTCGCTCTTCGAGACGCCCGATGGCAAGCCAATCCTCGTGCCGCTCCCCTCGGTGCACGTGGTTGGCAAGCTCGACCCACTCTACGACGAGTCGCACCGC
CTCGCGCTCATGTACGACCCGTTCCCGGCGGCGAGTCCGACCGGGAAGATCGTGCTGGAGCACGAAGAAGGCCACAAGTTCCCATCACTCAAGCACCACA
AGGCGTTCTACGACGAGCTCGTGAGCGCCATCTACCAGCACTGCGGAGACCCAAGCAACAGTGGTGAGGAGGCTCGTCTCAGCAAGCTCTGAGCAGTCTC
GAGTGCTGTCCAGTTCTGTACGTGTTCTTGATACTTTATGCATGCGTCTAATAGAGGAGCCACCGCATCTTCTTGCAAATACCATATACGTATAGCAATT
GCGTTTCTCGATGGCGTCGTTGTGCGCGTGCCGGGCTCAGTTAGGCTGTCGAGTTGACACCGTTTTATTACTCAGAGATTGACATAACCCGGCATATCCA
CTAGCGTGTGGCTGGCGCGTGTAAGGGGGGACGGGAACTAAAGTGGTTGTCTGTCTGGTCTCAACAGTTCTCGTCAAGCACCACAAAACGCGCTTGGCTG
CTGCTGAAAGTGAATGAGTGCATCGCTCTCGGTTGTTCTGTTTTTGCTCCGTTGCTGTGCCGCCGCGAATCAGGCTCATCTTCTGATGCAAATTAGTCAC
TTTCCACAAGCCTATCAGGCACACGCGTGTTATGTTATGCTATTCAGAGCATCACACTGTAGCTCAAACGCCCACGCACGCACGCACGCGTGAGCCAGCA
GGCGACATTCTTCAATCCTCACAGCAGCGCACAAGCCGCACGACACGACACAGAAGCCCAGGATTACCGGGATGACATCGGCAGGTAAGAAGACGACGCT
GCGCGTGCTCTGCTTGCATGGCTTCCGCGCGAACGTGCAGGTGATGAAGGACCAGATGCGCGCGCTGCACAAGTCGCTCGGAGCTGACACCGAGTTCGTG
TACCTGAACGGCCCATTTGAAGCCGAGGGCAAGGTATTCCCTGACGTCGAGGAGTTCTACAAGGACTCGCGGCCGTTCTACGAGTGGACACAGTACTACA
TCGGCGACGACAAGGAGTCGACGGTCTTGACCCCCGCGCAGATCAAGGAGCTCCGCGAAAGAGTGGGAGAGGGCAATCACTGGGTCGTCCGCTACGGAGG
CATGGAAAAGGCGCTTGAGTACCTGCACGAGAAGCTGGAGAAACTCGGACCGTTCGATATTGCGCTCGGCTTCTCACAAGGCGCGCAGATCCTCACGCTG
TACTCCATGTGGTATCTCCATAACTTCAATAAGCGCGTCTGGAAGCTCTTGGTAGTCTCGAATACGACCAGGATCAATGGTATGAACGCCAAGTACCTCT
TCGAGACGCCGGACGGCAAGGAGATCCTGATCCCGTTCCCGTCTGTGCACCTTATCGGCAAGAAGGATCCGATCGCAGAAGAGTCGAGACTGCTCATCGA
GATGTTCGACAGATTTCCGACGGGGAGTCCGACGGGGAAGGTCGTGCTGGAGCATGCAGGTGGACACCAGTTCCCGTCGTTCAAGAGGAACCCGGAGCTG
TACGCGGAGCTCGTGCATGTGATGAGCCAGTATCACAGCGACGCTGA