Description :
From Genome Similarity Track
Location :
Scaffold_728:10061- 12832
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_728-fgenesh-gene-0.4Histidine acid phosphatase

Sequence
2771 bases(100 bases per row)
GCCTCGCTCTCACCGAATGCGCGCTAATGAGGCACACCGCAACACGTTAAACCGCAACAACAGCTACACACATCAACACACGTTAAGCGCCTTACCAGTC
TGTCGCCGCGCGCGGTCATCTGCTCGATCCCCGTGGTCGTAAGATACCCGAATGGCCGCGTCTGGTACGGATTGTGCACGCCCTCGACCTGCTTCACGCG
GTACGTGCTACCTAGCTGCGTCAATTGCTCGGGCAACGGCAGCTTGGGCGTCCAGCGCTTGCATTCTTCCAGCTCGTCGAGCGGCGCGCTACCTTTAAAC
ACGTTGCGCAGCGGCGTGCGATCGCCATGACGGTGCAGTACCTGCAGCTGGCGCAGGCGCAGCGTCTGTGGCGCGTGACGGCGCATCACTACTACTTGAG
ATGTGCGTGTCGCTCTGCCCGTCAGTCGTGCACTGAGCTTTGTGTTCCACAGTCGATTTTTGCTCGTTTGGCAAGTCAAGAGTGTGTGTCAAACCAGACA
TGGGCTTGCAGTTCGGATGTAATTCGAAGACGGTCTGTGTGAGCAGTACGTGCATCCACGCGTACATCATAGGTCGAGTGTTAATTGGATGGAAGCACTC
TCGAGCGCATATGTATTGCATACATATTGCACATATATGCTTGCATTATTGGTAGCGTGACGGATGCAAATCGGTGCTAGCTGTGCCAGAATGCAAATAT
GCGCGCGCCGTTTCGAAACCACTTCCCAGCTGGTGCCGCACAAAAGCAACCGCGCGCTAAATGCGGCATGTCATCCATTACATGGGGTGTGAATGACAGA
CACTGCTGCTTTGATATTGAGACGTTGCCGTCGCTGCTGCCATAGTCCCCCACCGCCACCCCGCGCGTATCAAAGCGCTTCGCTTTCCTCTCGCTCGCTC
GCTCGGTTTCCGTGTGACTGACTGACGCTGCGTGTGCGAACGGACCGACTGAGTGAATGACCGTAGCATCATGGACACGGCCGCGCCGACACTAAAGAAC
ACGATGAACACGGCGCTCTCCATGAAGGACGTCCAGCGCTGCTTTGAGAAGGTGCGCTCTCCTATTCATTTCATTATCCATATGGTCCGTGGAACTAGAA
GAAGTGATACCCGTGTGTTGTGTCTGCGTGTTTCCTCCAACAGGAACGACGCGCGTTTCTGCGGGACCTCGAGACCCTGCGGCAGCAGCTCATCAAGAAA
GAGCAGAGCGCGAGCAAGGCCGCCGCGGTCGCGAGCGCGCACGCCGTGCAGCTCAAGAAGGAGATCGCATCGTTGCAGCACTCGCTCGTGAGCGCGGAGA
AGGAGAGCGCCAAGTTTCAACACCAGTTCGCGCACACGAGCGCGCTGCTTGAGACCGCGCTCGACCAGCATCAAGAGGACCAGGACAAGATCGCGCAGCT
CACGGAGAAAGTGCGCACGATCGAGAAGAAGCAGGACGAGACGATCGCGCTCGTGAAGAAAGAAGCCGCGGCGAGCGTGAACACGACCCACGAGGAGCGC
AAGGCGCTGCGCGCGCGCGTGGACCAGCTGCGCTGCAAGCTCGAGGCCGAGCGCAAGGAGTGGCAGATCGTCAAGCGACCGCTAGGCGAAGAGCTCGAGA
AGAGCCGACTGCGGCTGCAGCTGCTCGAGAAAGAACTCGGCGAAAGCCGCTACCGCGAGCACTCAAGCTTCCAGCTCAAGGAGAAGATGACCAGTGAGGT
GACGCAGTACAAGCGCAAGGTCGCGGACCTGTCGACCGCATTGCAGGAAGCGCTGAGGGGACGGGGCGAGCAGAAGGTGGAGCACTCGATGCTGATCAAG
AAGATGAAGGAGAAGTGGCGCGACGTGCTCCAGAGACACCAACACACGAAGGAGCAGCTGTTAATGCTGCAGGAGGACTACACGGGGCTCTATCGCACAC
GAAACTTGCTCTCGGAGCAGAATGAACGCATGTACCAGAGTATGAAGCAGATGAAAGTGCGCCACGAGCAGGTGGTGAAGACGAAAGACGAAGAGTTCTG
GGAGCTCGAGAAGAAGCAGAAGCGCATCAGCGTGATGTGCACAGCGTGTTTGAAGACCCCCGAGATGAAGCAGGAAGACGAGAACCGGAAGGTTGAGGCT
GTAAAAGAGGCGACGCGCCTCGCGGTCGCGAAAGAGATGGAGCTCGAGCGCTGGGACCGCTTCCAAGATCTGAATGCCAAGTACATGGACATCTGCAAAC
AGTACCAGCAGTGCACGAGGGAGAAGGACCAGGTGCAGGTTGAGGCGCACAACGTGAGCTGCGACTTGAGCGAGCTGCAGTTCAAGGAGAAGAAGCTCGT
CGACCTGCTTGAGCGCGCCGAGAAGAAAGCGCAGGAGCTCGAGAAAAAGCGCGAAGAGGACGCACAAAACCTCGAGGTGAACAAGAAAACCATGCAGGAG
CTGATGGAAAGCCTGACGAATCTCACGGCGGTGGTACGAGTGGTCATTATGTGTAGTGATGTGAATATGGTTTGATGTCCTTAGTGCTCATGTCGCTGTT
GTAATGTGTGTGGAATGAGTGAACTCTATAGACAGGAGACCAAAACAAACAGCTTCAGGATCTGGAGACAAGTCGGCGAGAAGAGGTACACATACCAAGG
ATTTGCTGCTAAGTTATCTCACTGTATGACTGACTAACTCGGTGTTTCACCGATCTTTACTGGGTTGTTTGCTTCCTTTCTATAGACGGAGCGTTTGACT
CAAGTGATAGATGACCTGGAGGCAGAGAAGGCGATTTTGCTGCAGGAACGAGAGGAGATGATCCAGCAGCA