Description :
From Genome Similarity Track
Location :
Scaffold_644:10061- 11348
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh-pve_contig_644-abinit-gene-0.33C2 domain-containing protein

Sequence
1287 bases(100 bases per row)
CCCACGCATCCAGGATCGCTTGGCGCGCCGGCTTGAGCGCCGGGTCTTTGCGGTCCAGCGTCTCGACCGAGATCCCAGGGAAGTTGTTCTCGAAGAGCGC
CTTGAGCTGCGGCAGCTCCTCCTTGGGCGGCGCGTACGTCCCGCTGTTGTTGTCCACCACCAGCTTGAACTCGCCATCGTCGGACTTTTCGATGTGAAAC
TCGCCGGCATACCTGTCAGCAACCACGGGTCAGTTTCGGAACATCCCAGCACCACTTCGTATCGAACGAGCAGCGACGTACAAGACTGAGAACTGAGCGC
CAGAGTGCAGCATGTGCTTGGAGAGCATATCCTTGAAGAAGGCCGCACCCGTCTCCGACAGGTACCAGCCCGTCTTGATGATCGCGTACGTGAATAGCAC
GGGCTTGTCTTGGCGTCTGCCCTCGTGGAGCAGCTGGAAGAAGTCAGTGGGGGACGTAATCTCACCGTACACAGTGTTTATGTCGTGCTTGTAGACCTCG
GCGTGCTCCGTCGCGACCAATTTGCGCAGAGCGGGAGCCTCCGGGTGATCAGGCGAGAAGATGCGCTGCACGGGCTTGTGGTCCTTGTTCCATTCGTTCT
CGGTCGGCAGGAAGCGGTGGATGTTATGCAGCTGGATGTGGTACGCCAGCGACTCGAGCTTGTGGTCGTCCGTCACGGACTCGGTGATGACGCCGGTCGC
GACGCTAGGGTGCACCGAGTAGTGCACCGGGCCGTACTGGTCCAGCTCTGCGTTCGGGTCGGCCTTGGTCGCGTGGGACTTGACCTTGACGATGATGGTG
CCGGCGCTCTTGTCCTCCTTGGTGATCGGCAGCTCGAACGTCGTCTCTTCGCCATCCGTGTTGGTCGCGGTGAACTGCGTCTCGCCAAGCGGGTCGTCGG
CGCCGACGTCCTTGTCGAGCAAGTACAGCTTGCAGAGCGTATCGGCTCGGACGTTCCTGAAGAAGAACGTCTCGTTCCACTCGGGTTCGAGCGTGTCGAA
GATCGGACGCGTCCTGATTGGTGCCAGTGCCAATGTCTCCGTTAGACCGAAGCAAGCCAGAGGCGATACAAAGCGGTGCTTACCACGCCACCTTCTGCCC
GTCGACCTCGATCAGCGCGTACGCGTCGCTCGAGGACAAGTGGCCCTTGAGCGCGGCTGCCGCACCGAGGTAGTCGCCAGCGGCGATGCCCTGCACAACA
CGAATGGCATCAGCAGGAGCAGCAAGCTCGGAGAGCACAAGACAAGGACGCGCACCTTGGCGGACACGATCTGCAGCTCGACGTCGA