Description :
From Genome Similarity Track
Location :
Scaffold_149:1006- 21846
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_149-snap-gene-0.5Regulator of chromosome condensation (RCC1)
Pytar_ATCC12531maker-par_contig_149-fgenesh-gene-0.1Regulator of chromosome condensation (RCC1)

Sequence
20840 bases(100 bases per row)
TCCATGGGCCAACCAGTGTCGACGCTCGCGTCCGGACCTGGAGCTGGATCGTCCAGTACGAGCGGCACACGCGTCGCGGCAATTCCGCCCTACTATCTTC
CGCTGTGCGAACAGGTCAAGGCTGGTGATGCCGGTGCCGCGGTGTCGGCGACGAGCGACGATAGCAAAGACGCGCAAAGCAAGATTCTCGAGTTTGGCGC
AGCGCTGCGCTCGCTGCCAAAAGGTGCGTAATGAATCACGACCGGAGGGTGGAAGGGAATGATGTGGATACTGACCGTATATGGATATCTTTGGCAGATC
CAGAGAATCTTAATGGAAGCTATTCAGCCTCTGCGGTCCCGGGGAGCTCTGATCAGTATCTCCAAGAAATCCTGAGTGCCGTCGACTCGGCCGACGAATT
GTTTCAGTACATCTCCAGTCTCGCAGCGCTGCCTGCGGATGTGGAGGCATCGGGGACGCATGGAGATGGGTGCATTGATGCGCGCATTGCCGCGTACATC
AAGTCACTCCAGCATCTGTACCACATGACCAAGAAGGAAAAGCAGCGCGCCGAGCAGCGGCTCCTCGCAACACGTACTCAGGCCTCGTCCCAGCGCAAGG
CCACGCCGCCACCGCTCCCACTACCGACACAAAACTGTTTGACCATGGGATGGGAGATCGTCGTGCTCTTACTTAAGGCGACCCGTGCCGAGAACCCGAT
GCAGTATCGTCAAGCGCTCCATTTGCTCAAGGAGAACTTGCGCACGCTGAAGCCCACGACGTACGCCGACAGTATGTACTTGGCGCCATCGGCGTCGGCG
TCATTCGATGCTCTGAGCGAGTGCCTGAACGTACTGGCACAGCCATTGCCTGACAGAGACCGCGATGCCGAGTCGGTATTGGGCGCCACGACTATGGAAA
CGCTCGCCGAAGTCGCGCTCGCACGAGGCTCGTTGGCGACATTGCTCCACGTCGTGCTGTGGCTCTTCAACCAGACACCAACAGCTACCGTCGACTTGGG
TGTGTCACTGTCCAAGCTTGCGGGATTGAAGGAACAGCAACTATACGGCAAGTGCGAGGCGTCCGGTGAGCTTTACTGTTGCGGCCAGAACTCGTACGGC
GAACTGGGTATCGGCGACGACATTGAACGCCACTTGCTCACAAGCGTCTCGCTCAGTGGGTGGGACGATATCCGCCAGGTCGTCAGCGGCAACGAAGTGC
TCGCGATTCTTACCAATGGCGGCGTCGTCCTGACGTGCGGACTGAACAAAAGCGGCCAGTGTGGTCACGGCCACTTTGACGAACGTGTGATGTGCCTCCG
GCCTGTGCAGGCGTTGCGGTCCCAGAAGATTAAGTTCATTGCCGCCAGCAACGGGTGCGAACACATCATCGCGTTGACCGAGACGGGACTGGCCTATTCA
TGGGGGTACAACGACCGCGGGCAGCTCGGCCACGAGAACCTCACGACCAAGATCCATCTACCAAAGCTGGTTGAGTCTCTGAAGGATAAAAAGATTGGCT
TTGCCGCAGTGAGCTACCACCACAGCGCTGTCGTGACGGAAAGTGGCGAACTCTACACGTTTGGCATGAACGACTGTGGGCAATTGGGCTTGGACCATAC
GCAGCACATGGCCGTGCCGCAACACGTCAAGGCGCTCGAAGGCAACGAAGTGTCGATGGTTGCATGTGGACTCTACCACACGATCGTTTGCACGGCGTCA
GGAGAGCTGTTTGCATTTGGAAAGAACGACTATGGTCAGCTCGGGCTCGGTCATAGCCGCCAGGTCAAAGTGCCCACGCTTGTCTCGCTTCCCAGTGAGA
TGGTGTGCTTTGTGGCATGCGGGTACTACCACTCGAGTGTGGTCACGACGTCGGGGCACACTTACAGCTTTGGAAGGAACGACTATGGCCAACTCGGTAT
CGGCTCCAAGATCCATCAGAATGTGCCAACGATGGTCGCGCTATCTGCGACCACGCGGATGACACGGGCGACTTGCGGGTGCTACCACACGGTGTTGCTT
TCAGAGCAGGGCCAGGTGCTCGTGTTTGGGCGCAACAATAAGGGCCAACTCGGGAATCGCAGCAGTGCCGACTCGCTGTTACCCGTGCCATTGAAAGTTC
GCCCCGAGAAGAACTCGCGCCGCTGCATCGATGTTGCGGCAGGTTTTTACACGACGTCGCTCATCTTTGAGCGCAAAAGAGACAACGATGACGGCGATGC
CGCTGTGGTTGTGGACCAAAACTGCCTGGTATCGGTGTGCGGTCGCGTTGACATTGACCGCTCGGGCGAAATCGAAGGGCTCAGCAACTTTGGCTCGGTT
TCTACTGTTGGTATCGCACTGTTCGAAGGCAAGTGGTTCTACGAGGTCGAAGTGGTCACGTGCGGCCTCATCCAGATCGGTTGGATCGACAACTATTTCC
AGGCGAGCTCGGACCAGGGAGAAGGCGTCGGCGACCACACGCACTCGTGGTCGTACGATGGTAATCGCCAGCGTCGCTGGAACAGCGGCTCCAGCTCGTA
CGGTGAGAAATGGAAGGCAGGTGATGTGATTGGATGCCTGCTTGACCTTGACGCCCACGAGATGACCTTTTATCGAAACGGCATCCACCTCGGTGTGGCC
TTTAGCGACGTCAAGTGCAACCCTCTGGATCGACGGCTTGGTCTGATGCCGGGTATCAGCCTCGAGCGAGGTGAGATCATCCGCGTGAATCTCGGTCATC
AGCCATTTGCTCATCCGCCGACCCACGTCGGCGACTTTGACGGCGTATTCAAGGCAATCCTGCCCCCTGCCACGGCGGCGTTCGCGCGGACTTTATCCGT
GGAGCAATCCGAGCTGTGTCCACCGGCGACCGAAGGATCCGCAACGGTGCTCGTCAAGAACAAAGTGTTTACGATCGGTGGCAGCCTGTCAGGCAGCAGT
GGTGGTGGCAGCGAAGCGGAAGCCAGTACCCAAGTGTGGGCGTATTGCCAAGATACTCACAAATGGGAGCGATGGGCGGATTTTCCAATTGCCATTCGCA
ATCATCAAGCCGTCCCGGTTGGGGATGATCAAATCCTAGTGATTGGTGGAGAGAACACAACACCAACGTCACGCCACATGGATTTGTACAAGTGCTCGAC
CACCAGAGGAGAAGACGGTTCGCTCCCTGTGTGGGAGTTGGTCCAGGGTGCGGTCAGTGCATCCTCAAACGCTCTCCCTTCTCCGCGCGCCCACCACGTT
GCTGCGACGATTCGCGCCCGCCTCGATTCCATGGTGATCGTCTTCGGCGGCAAGTCTACCGACAATGAAGTGCTAGGCGATGTCTGGTATCTATCACTCG
AGGACTATTCATGGTCACGGCTGCCCAACTCACTTTCGCTCGACCCGGGACCGCGAAGTGGCTGCTCAGCTGCGGTCATTGGCGAGAACGTCTACGTGTT
TGGTGGCCAGGACAAGGAAGAAAAGCTGCGCTCCGATCTCTGGCGGTACAACGCATTCGATCGTGTGTGGCATTTGTGCTATGATGACAATATCACGTTT
GCAACTGAAGGCAACAGCGTGGAGGATCCCGCCGCAAAAAACGAGTTTGCTCCCACTGTACCTGAGGCACGGTCCAACTATAGTATCACCGCCGACTTTG
GCAACGTCTGGATCTTTGGTGGCGCGTCGCAGTCTGGCGCATTGCTTCGCGATTTGTGGTGCTATAGCGTGACATCTCACAAGTGGAACTTAGTGGATGT
CGCGTGGGAAGAAGATCAGGAGGAGAAAAGCAGCGAAGGATGGGCCGGTGCTGCACTCATGATCTCGGCTGGCTCGGCCACGGCGCTCGCCAACGCCTCA
AATGATGGTGGCCAAGTCTCAGGACGTGTGCTTCCCCACGTGATCCTCTTTGGCGGTACAGTTCAAGCCGGTGGCGTCACGACTTCCACGACGCAACTGC
GAGAGCTGGTTGCGATTGACTCGACGCGGACATTTGCGGCCGATCCAGCCAAGAGCCTCGCGACCACGGGTAAATCGTCGGTCATCCTGGGTACTCTTCG
AGCCAAGTGTACAGCGGGCGGTACCGGACGCACCTCCCAGCAATGCCTCCCGCTTGCGTTAGACTCGGGCGTGTGTATTCTATCGCATCTTGACCGACTT
GCCGGCAATGATATCCCTGGCGAGGATATCGATACGATCCAACTGTCACGATGCTCGTACCGGACGTTGTGTGTGGATCCCAATGAGCAAACGCTTGCGG
CGCTGTATACGCTGCTGGCGAAGCTTTCGTCAAGTATGCAGACTGTATTTAGGGAGAGTTCCTCAACCTCTTCGGCAACTGTCAACGTCGTGGTCGATGT
GCTCTATCCGACTCTGGTTGTCATTCGCCTCCTCAAGTTGAATCTGTTTGAGCTGGCGCGTAGCAGCATCGAACTCACCGAGGTCGGCTTGCTGCCAAGT
TCCATACTTCCGGGTGGCACACTGTTCTCCCTGCGTGAGATTCTGTTCAAGATCGCCGAGCATACGCCACTCGCAGCGCCAACGGGAGAGACAGCGTGGT
TCTACCGAGCAGTCAAGCAAGAAACGGCGGCCACTATATACCACGGATTCTCCATACTGTTCCCGTCGCTTCTCGATCGCGTCGAAGTCATGAACAAGCT
CATGCGAGATCCTATGGAATCGGACCCGACCCAGAAACTACTTGTCCCAATGCTTGTTCCGTGCTTTACATCTACCAAGATGCTGTTCCAGCTCATGGAC
GAAGTGCAGGCGACCGCCGGTAGTCGCTCGGCGTTTGATGCCCCCGAGGTGGTCGCAGAATTTGCGTCCACGTTGCTCGAGACACTGTGGACCAGGACCA
AGCACATTCTGGATGCTATGGATACGGAACAAGGTCTCACCTCGACGCTCAAGAAACTGGGCGATCTCGATACCACGAACGAGTTTCGGTGTCTCAATAT
TTTGATCCGCTCGGGTGTGTACTGGTGCGCACACTCGATTGCACGTGGGTGGCCGGTCATGCTCTCTATCAGCGTCAAGCTTGTCACCTGCCTCGATGAG
CTGTTGGCGATCCGTGATTCGAATTCTACCATCCTGGCCTCTCTCGTACAGCACACTTTTGCAAGCAAGCTTTTGCCGTTTGTGCTGCTGAGCGTCAGCT
CGCTACCAAGCGTCCGGGAGGCTTTTAGCTCGACTTTCGCGCCGTTCTGGCCTCATCTGGAGACATTGCTGGAGCGTGTGCACTCGACGCTGTCCACCAT
GAAGCCACAGAGGCGTCCGTCCTCGGAAACCGAGTCCTTGCCTGAGAGAGAGAGCAGTCTGTGTCCATCTGATCGACAATCTCTACTGACGTCGGGTACA
CGAGTCCGCGTCTCGACTGAACTGGGTAGGGCAATTGGTCTCGCGACTGTGACCTCGTCTGTGCTTCCGTATGATGATGTTGTGCGTGCGATCTGGAGAA
CCATTGGAGCATGTGAGAGTTGTCGTGCCAACAAACTCGCAACGCTCGAATCGGCTTATCAAGTCGGGTTGCCCTCGGAACTAGCCAAGCTCTTCGGCGT
ATCTTCTCTCACAGTCACTGTCTTGCAGATTGTTGGCGACCTCCCACACGACTATGGTAAGCTGAGAGACGTGGACGCTGCAATGCTTTCGTTCGCGCCA
AGTACGATGGTACTTTCACAGCATATTCACGTCGACGACGACACATCGGCCAGCATGTTGCTTCCTCCGGCGCCACCCGTCCATCGCCATCACCATGCGA
GGAAGCCTTCACGACAAGAGTATTATTCCGCTGAACCCAGCATAGCGTGGCTGCGAGATCTCCACAACGTGCTGGTGTGGCTGGGTAGCCATTATGCGGC
ATCATTGGTAATTGGCGTGAGTGCCGTCGATGCGGAGGCCGACATGGATCCTCGATGGATGCAGTCACCACTCTTGCGTGGCGGGCTCGCGATCACGACT
GACGCCGAGCCTTTACAAAGCACTCGTCTATCAGATGCGCATGATGACACGCGTCGCAACGACCTCCTTCTCCAGCAAATCGTGCAGGGTTTGGGCGCCG
GTAAGAAGCTCGTTGATAAGGTGAAACTTGCGTTGGATCCCGGCACTGCCGGTGCGGTTGGGGGTGCCAACCCAAAGTTGATGGCCGCGCGTTTGAAGCG
TCAGGACAGTGTCGAAGCGGCGCTGGAAAAGAGCGGCGGTATCGATGTCGTCGACAGAGCCGTGCGAGTCGCGTTTGCCGTGCAGCTCAAGCACAGTAAC
GCCGCTTACGTGAATGGGGGACTCACGAAGAATGGCACGCCGTCGGAAGCCGTGATTGACGCCTGGCGCTCGGCACTTCAGCTGCGTCGCTGGTACGTTG
TGGAATCCTCTACATCCGATCGATGGCTATCCTGACGCTTCGTTTGTGTTGAACAGGATTGTGCGAGAGCAACAAAAGCTGGCAAGTGAGCGCAGCGCCT
CGGAACTTGCGTCTTTAGACGCTTCGTTACTCAAGGAGCGTCAGCTCACTTTGTATGCCACCGTCTGTGGGCCGCTGATCCGCAGGGGGGAGCTGCTGCT
GCTGCTGGCCCCGGCGCCGTCTTCCACGTCGCCGATATCCCCGCCCACTGGCCTGAAGCTGCTACCTGGTGTCTCGGCTGCCACAAACTACGGTACGCGC
AGTGTAATATGTTAGTTGTGTCTCTCTGGAGCTAACATACTACCTCTTTCTATCAGATCTGCCCAGAGCCTCGTCCGCCATGGAGGATGCACCGAGTGAG
GAAAACGAAGAAGCAGCGCGTCAGCTCAAAATGATCATGAACACAAAGACGATGGACATGATCGAGCAAGAAGACGAGAAGATGCAGGCGGACATCTTCG
CGTTTCTTCAATACTCACGTAAGCCCAAAGCAGTGCCAGAGGACGGTGTCCCAGAAGATCTGTGTGATCGCGTGCTCGCGGCTCTGCAGTCGCATCAACA
CAAGGGCCAGCAGCGCTTGAGTGGCTTGCAGATCTTCTCGCGATTGCTCCATGTGACCGATTCGAATCCTAGCTGTCGGCGCAGCATCATTCCATCCCTT
TCGACTGCATTCAAACGGTTCGTGCACCGTGGTGATGCCAATGCGTCGGTCGCTGTCGAGAAAGTACACTACTCGGACGGGCTGGAGCTTGCTGGGCCGT
GGCTATTCAAGAATATTCGCGATGAGTTCTTCAAGCTGTTGGAGAGTCTGTTGGCAATTGGCAACGACCATGTGGCAATCGTTCGCCAGTCAATTGAGAA
GGGAAGCTGTGGTGACCTCACCGAGCTCAAGGCTTTGTCCTCCCAAGCGCATGAGGCCGTCTTAGAAGTTGTCCAGATTTTGGAGGCCTGCAGCGTTCCC
TACCAGGGCGACGACTGGGATAGCATCCACACGATCCAGTTCCTGCCGTTGGTCACAGAACTATCGAGCTGGCGAAGCTGGAAGACGACTTTGCAGTTGA
ATTTTGTCGATGATCACTGTGCCGAGACACCGGGCGGTGGCGTGATTCCCATTCTGGCGGCTGCCAGTGGTCAACGTTGTCCCAAGATCATTTGTGCGCG
GGCAATCACGATCGGGACGGACCTCCAACAACTCAAAGTCTCTGGTAATCAAGGCGGTGGTGGTGGTATGGCCGTATTCCATCACTCTCTGAACCGTGGA
CGATGGTATTGGGAGATTTCGATCTTATCCCAAGACGAGCGGTCCGTGTTTATCGGGCTCGCGTCCAACACGGACGATCTGAACCAGGCAATGCCTAGCC
AAACGCACGTCGGCATCCACGTCTTTAGGGACACGACGGGGCTAGTGGTGGGCAGCAGCGAGGAGGGATCTCCTCATCAGATACCCAGTCTTCGTTGCCC
ACTTGGAGGCACCATCGGCGTGCTGTTGGATTGCGTCGACAAAACGCTCACGTTCTTTGTGGGCGCGCGCCATGCCAAGGTTCTCTCGTTGGAAACCTCT
TGCCACGGCAACGTTTACCCTGCCCTCGGTCTCCAAGGCGCTGGCACCGAGTTGTGCTGGAACCTGCTCGCGCCTGTGCCTGTCCGTATCGGTTCAATGA
CCAGTGGCTTTCGCTTCTCGGCGCCCGTGGTCTCGGGTTGTCTGATTGCCAGTCCCATCGATGGCAAGACCATCAGTTTGGACGCAAAGACCAAAGGACG
CCGACTGAGACTCTCTCCAGATGGCACCGCCGTCATCGCTGGAGACTTTAGTATGCTCTCGGAAGATGACGTGGTCGAGACAATCACCGCCAATCAAGCG
TTTGAGACCGACGCATTGTTTGCCGAAGTTCAGGTTCTCTCAAGTGGACGTGACGGTAGGTGCCAGCTCGCGTTCGGCCTTGTCGGTGTGGATATGGCCA
TCGACAAAGACTTCATGAAGCGGCATGCCGTCGAGGTGACCAGCACTGAGGACGCGCTGCTGACGGGTGCGTTCGGCGTGCTTTTCGAATTCGCGAGTGG
CAAGGTCACAGTGTACCCACCAAGCGGAGGCGAACCGCTGAGCCGCGTGGTGTTAATGGAGACGGCCACTTCCAGACGCCTTCTAATTCCAGCTCTTTCG
GTGCTGTGCAATGGATCAGTCTTCCGCGTCAACTTCCACCCGCGACCGCGTCCGGAATTACCGCTGGCGAATGCCGTTCGACCCGCAAGTATCGGCGACA
ACTGCCATGTCTCATCGTCCAACGACCTCCAAGTTGGCAAGGTGCTAGCTATGCACGTGCTCAACTGTGATGGTGGTGAATTCAGCGGGTCCCACGCCGC
AAAGAACTGTCTGGTGGATGATGCCTCGGTATTCAGCTCAGCCAAGGGACGCAATATCCATCTCGTGTTGCGCCATGAGATTGATACACCATTCTGCCTC
AGCTACCTGACCGTTCGTGGCCCGGGACCAGGATACTCGAGTCCGCTTCGCCACGCTCTAGTGTTTGTCACCAGTTCTGTACCGGATTTACAGCGACTGC
AAGAGTACGATGATTTTACACCCGAAGAATTTGCATCTTTGCCGTTCCCAGCGGCCTCGCTGCGAAGTGACAGACTGGAGTACATGCCGGTCGCGTACGT
CGTGCTGGATGGCAGTTGTGCACAAGTCGCCAAGCAACTCGCTGTGCCCGTGCAGGGGCGATATATTGTAGTCAAGTTGCTGTGTGCATCGTCGTCCTCG
TGTACCAATATCGACGTCGGGTACGTCGGCTTTTGTGGCACTTTTGACAAGGACAATGGACCAGCCTATGCCGACCATGCTGTCACCGCTGCGGTCTGTG
AAGCGTGCCAAGCGTCCTCCCTCTATGGTGTGACCTACTCGCTGAAAGAAGATGATTCGGTCAAGCTTTGTGCCTCGTGCTACGACGACCATCGCGGCTC
GCTGGAGGCCACATTCTTTGCCCACGTTGGTCTCGAGACTGTCGATGGTCAGGGCGATGACGGCTTTGCGCTGTGCGTGGCTCGCAAGGCTCACGTCGAG
TTGCTGACAGCGCAAGTCGCACAGGCCGCATGTAGACGGTCTCGGAGTCCTCCGGGCAGCAACACCAGCAGCGGACCAATGCCGATGTCCATGGACTCGT
CCGTGGGCGGGTACCTTTCCGAAGGTGGCACCAAGTCGGAGCGAGCCCTTATGTGGTTTGACGACTGTGAACTCTTTTCGTGTGGCCAAAATAATTATGG
GGAGCTGTGTCTGGGCCACTGCAACTCGACCACAAAGCTCGAGCATGTCCCGTTCTTCTCGACCAAAAGCACGCGCGATATTGCTGGCGGTAACGAAGTG
CTTGCTGTGCTCATGAAGGACGGTACGGTGTTTACGTGTGGGCTCAACAAAAGCGGTCAGTGTGGGAACGGCACGTTTGACGAGCGCGTGCTCGCGGCGA
CGCCCGTGCGAGCGTTACAGGGTGTCGCGATTGAGATGATTGCCGCTGCCAATGGCTGCGAGCATATGCTGGCAGTTGCGTCCGATGGTGCCGTCTACTC
CTGGGGATACAATGACCGCGGCCAACTGGGACTGGGCTCGACGATCTCCAAGAGCCACACGCCGCGGCTGATTGAGTCGCTCCGTGAGAAGTATGTGATC
ACGACCGCGGCCGTGAGCTACCACCACAGCGCCGTCATCTCGAGTGCTGGGGAATTGCTCACGTTTGGCATGAACGACTGCGGCCAGCTAGGGCTTGATC
ATCTCCAGCATCAGCATACGCCGCAGCTCGTTGATGCACTCTCCAGCCAGGTCGCAGTTAAGGTCGCATGTGGCCTGTATCACACGGTCGTTGCCACAGC
TAGCGGTGAGCTCTATGCATTTGGAAAGAACGACTATGGGCAGCTTGGTTTGGGCCACGCTCGCAACCTCAAAGTGCCAACTCTCGTACGCGTCGCGATT
GGCGACAGCGATGAGCGGATAGTGGATGTCAGCTGTGGGTACTACCACACCGTCGCGATCACGGACAAAGGCAAGCTGCTCACATGGGGCCGTAACGACT
ATGGACAGCTGGGCATTGGCAGCAAGGATCACAAAAACACGCCCCAATACGTGCCACTGCCGCTCTCGTCGCGCATCCGCAAGTCGTCCTGTGGTTGCTA
TCACACACTGATCTTGCTGGCGAACGGCCGCGTCATGGTGTTTGGTCGCAACAACAAGGGCCAGCTAGGTGCTGGGGCCCGCACGCTGCCATCAGCGGAT
CTGCCGCTACCCATTCCGCTCCACTCACTCTCGAACGACGAGGTCATGTGTGTCGCCGCGGGCTTTTACAGCTCCTATATTTTGACGGGTCGCCCCAGCC
AGTCGCAGGACCCGGAGCGGGCCAAAGAAGACCACGCGCAGGCCACAGACCTTGCTGAGCAGCACAGCAGTTCGCAGGCGCTGTACGAATCTCTGATGAA
GGAGATCGACCGCAAACAGCACAAGCCGCTATCTATCGAGAAGGTAGCATCGATCCAAATGACGAAACGGGCGAGTATGCGCCGCAAACTCCCGCTATTG
AAGCTCCACGCGGCGGCGTGGGCCATGGTGCGGGCGCTGCTGTACCAGTCGTTGGGGACGACAGATATCTCGAACAGCCAGCAGCTCGCGGCGTCAAACA
AGCGCTGTGTGGTCTCCCGAAGTCTTGCGGCGTTTTTGCTCGACAACATGCGCGAACTACAGAACGAGATTCTAGAGCTACGATCACATGGCCGATGGGA
CGCGTCGTCCGTGACACTGAAGAACGCGTGTGTCGGGCTGCTCACACAATGTGTGACTCGTTCCCAGATTCCACATACTCCAGTAAGTCTCCATCCCGAC
CGCCTGCCGCTGCCTTCGCTGTATCCGCACCTCTTCCGCAATCAATTGCTTTGGGTGCTGCTCTCGTGCGGGGCCGCTGACGCTTCCTTGTGTTCGGTAC
TGGCATCCAACGGCCACGTACTGGACGAAATCTTGAGAGGTATGACCGCGTCTGATCTATCGTCGGCAACGATTTGTATCCGTCTTGCGATGCTCGTGTT
CCCGATGCATTCTGTGTCATCCGTAAACGCCGCCTACCGCACGGTCCTCGGGTCGACTACAGCTTTCGCCTCTTCCTGCCCCAATATACTCAGTGTACTG
ATGCTAGTTGTCGGCCATCCGCTCGTGCTTCGCCCACGACTGTGCAGCCATGAGTTGGGTATTGAGCGCTCGTGCTCACCGCTGTGTGAATCAGCGAAGT
GCTTGAAGGGGCTCGCTGTGTCTGAAGACAAGAATATCAACGGGCTCAAGGAGGACGTGTTGGAGCGCTCGCATATCGCGGCGGCCAAGGCCGCCGAAGT
CGTGGCGTTGCTTCGGTATCTGACTTTGTACCCCACATGGAAGGTAGCAGTGAACGCGAGTATCACCAAGGCTTTCGCCAAGACCGAGATGATCGGCGAA
ATTCTGGATGCCGTGTGTGCATATTATGCAGGCATGGCCGGACGCGACGCAGAGGACACGGAGGAACCAATTACAACTGTGATTGAGCCGGTTGAGACTG
AACAGCTGAATGATATCACGACGACCGCTCAGGAAAATGCCACGCGAGAACCAGAGACCACGACCGCTGGGTCGCCGGAGATCGATGACACTGGGATTCC
TGAAGGGCGGGATGATGCTGATAAGGAAGAAGACGATGCACCATCATCGGGCGTGTTATTGGATACTCTTATCAGAGACAAGAAGGATCTCCAGGTTTGG
CAAAAGGCGAAGGAATCGCTGGACGCCCTTGCCAGTATTTTGGCAGCAGTGTGTCTTGTTGGTGGGCACATCGAGACGCTGCGAGAAGGTGCAATCGCGA
TCATTGAAGATGCTGACCACAAGAGCCGCGGCAAGGCCGGTGTGCTCTCTGGCATCAAAAGAGACCCACGCGGAGAACTCTGTGCGAGCGTGCAGCTCAT
CGAGTCCTCCACTTCGGGTTGGCAGCCGCTGCAGCGTGGCGGTATCACAATCAGCAGCGTTGGTATTCGCAACCTCAAACCTGTGGAGCGCGTGCCGGCG
TTGCTTCACATGTTTAACTGCCTTGACGGCGTGATCTGCTCGCTCTCTCTGCTCGTACTTCCCCCAAGCCATGACGGCCACGCCTATTATGAGCTCAACT
TGCCTCAGAACAATCGTGTCCAAGAAATGCTCGGGAGGCGCCTGCAGCTTTACAGCCAGCAACTCCAGTGGCGTGCAACCATGGCGCTGTCTAACCTGCT
CAAGCAAATGCCACAGCTCAGCACGGAGCTCATCAACGCCGACACTCAGCTTCTCTCGAATATCGCGCAGACTATCGCCGCGGAAGACCCGCTCCAGAAC
ACTAGTGCCCTCGCCTTGGTTCAAGCCTCCTCATCAATGACCACCAATGTCGTCGACGTTTTGCACACTCGCTGGGTTGGCCTCAAGCAGCGCCAGCTGT
GGCTGGAGACGGACCACATCTTGGATGACGCGCTGGACTGCTACGAACTCGAGACACGCGACGATGTCGTCCGTAAGCTTGGCCAGCAGAACGCATTGTC
GTGGGGACCCGACGCGATCCAGTCTCCACGCAAGGGCTCGACATCGTCTTCGTTCTTCAATGGGAAGTCGTCAGGAGCTTATCAGCTGGGTGGCCTACAG
CGTTCGGAACGTGACCGCACGGAGGCCGGAACACGACCTGGGGGGCGTACCACACTGCCTCAAGGTGCGTGGGGCGTACTGCATCCGCTGCCTCCGCTGA
ATGAAAACGAGTCGGGTGGAGTATCGTCCCCAGCTGCGGTTGACGCGGTGCCGTTCCCGTTGACGACTCCGGTCGTTCGTGTGGGGAGGGCGGCAGATTC
TTGTGATCTCATCGTGAACGACCGCAGCGTGAGTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGTATCAGACGTGACCACC
ACGAAGGAGGAGGAAGTGTCGGTGGCGCGGAAGAGTTCTTTGAGCTGCAAGACTTTAGCAAGAACGGTACGATCGTGAATGGCGTACGCGTCCACGGCAC
AAGCGTGCGGGTCACGCCGGGGTCGCGAATTTCGCTAATCCTTTCACGAGGAGGTCTCGTGACCTACGAATTCCAGGTACGACCGTCGCATGGATCTGCT
GGACTGACGACTCATCGCATGGCACCGCCGCCGCCGATCCTCACGGGGCCTCCGCAAACGGTTGATAGCAATGTCACGCTCATCCAGGGGCAAGAGTATC
AGCAGCCATTGAGCGCCGTAGGGACAGGTCCTGCTCACATGGAGCCGCGCAGTCCCGCTGAGATCCAAAACCGAGGCAGTAGACAACAGTCCATGGAGAG
TGTGCGAAGCCGTATGCCCGGTGGCCAGGGTGGACTTCGCCTCATCACGTCAATAGCTGAAAGCGAAGTGCCGCGTGCGTTGATCTCACCAAACCCGGCC
GTAGAATCCCCGCGGGTGGGTGGCTTTAGCTCGCCTCGATCATCCATTCTTCAGGCTCCGGGAACACCAGCAGTGCCCTCGGCGACAGCCAACCTCTTTG
CGAGCCTAGGACCTGCCGGCGTGCTGTCGCCGGCGTCGTACCAACAGCGAGAGAGTGCTAGGGAAGGTGGCGAGGCAGCCATGCTTCGGGCTCCAGAACC
GACGACTCCCGGAACAAGCAGCGATGGCCTGCGCATTGCGCTGGGTCGTGACAGCTTCACAAGAGAGAGTGGCCAGCACAATAGCCTTGCGGCGACCTCA
GCCGGAATCACGGTGATGGAGCCACCACGGCTCAAGACGTCCCATGGACTGAACGAAGGCAGAGCCATGGCCCCCGTACGTTTGCAGTTTACCTTGCCGA
GTCCCTCTGATTGGGGCAGAATACTGACTTTCGATATCTTTACAGGTGTCCCCCGCGTTGGATCTACTGGCTCGGTTGCGAGGCGTCGGCTTGCTTCACA
CCACGGTAGAGCAGTGTGAAGAGGCTTTGCATGCCATGCATGGCGATGAGCACAGTGCGTTTACAATTCTCCACGACCAACTATTGACCGAACAGACGAC
ACGACGCGAAGGGCTTCGCTCGCCGACGGTTCAGCGCCTGGCCAACCTGCTGAATGTGGACCCTGTCGCGTGTGCTGAAGCACTTTGCCGAACGCAGCAA
AGCGTCCCTGCGGCAATTCGCTTGCTGCTGTCGCCGTCCGGGGCTGAGTTGATTCGTACCACAGCAGTGTCTGCGTGGTCATGGCAGAGTTCATTGGATC
CAGATTATATCAACGACACTGTGGTGTTTGGTACGAGAAGTGACGGACTCATGAACCTACAAGAACTCATGGAAGAGAACCCGAGCTATGCACTGGCGGA
ATCGAGTGCCATGACGTCAGGACCTCCTCGGGCTCGACCCGCCAGCCCATCCAAAAGCAATGGGGCTGGGGACGCGGCCAAGGCCTCGATGTCTCCACTG
GCGCTCTGGATCGAGTGTTCAAACCAAGTAGTGGACGACCGGCTGAATCAGCTGGCGCCGCTTGAAATGGAAGACGAAGAGTTATCGATCTGTGGACTGC
TTACCGCGGTCCATTCGCGGCAACTGCTGGAGCAGATCGTTCGGCTCTTCAAGAATGTCCCTGACCAAGCCGACAACCTGCTGGCGGCCTTTGGCGACCC
CGTGACGCTTCGCCACTTGATTCTGTTCCCGTCCAGCGACACAACGACTGCCGCAGGTCCAATGGTCCAGACAGGGATGGCTCAAGAGTGTAGCACGATC
CAGCGGATCCTGAACCGGTCGAGTAATGACACGTTTCGGTGTGCGTCATCGAGCTCACTCCAGACCAACATGCGCGCAGTACGGAATCTTTCGGCGCTGT
GTCTCGCGATCGACCAACGCGACTGCTGGTCCACAGCAACAAACGAGACTGCTGGGTCAGATTTGCTGGCGCAACTCGTCCGCACGCTCGTTATGTATGA
GTGTCAAGCACTTCGTCATGACGACTCGGGCCTGCTCCACCAGACCACCATCCTCCACAATCTCGTGGTTGATACGCTGCTGCATTCGCTCTCCCGCACG
TTTGTCCACCAGGGCTCACTACTCAACTGGGAGGCGGCCGTGGCCAAGTCGTCGCGTCGCTCCGCCACGGAGACGATGTTGTACCCGAAAGGTCCGATTC
GGCTATCTTGTGGTATTGAATGTGTCGTGGTCGCGTCGTACGAGCGGGTTTGGAGTGTGCCCTCACCTGATCCCCTGCTGCAGTTCCGCCACAAGTGGAG
AAAGGTTTCGGGGAATGGTGGGAACAAGGCGACGCCCGACGGATACGTCACGATCTGGCGGCCCGTCCTTCCCAATGGCGCCAAGTTCCACGCAGCGACG
ACGGCGACTCAGGCAACGTGGTTTGCTTTGGGTGATGTGCTCCAGTCAGGAGGCGACTACCCTGACGCTCCGGTGCTGATGGTGCGAGATGACGCGTCAG
GTCTCGTACTACCACCAGTCGGATTTGAACGTGTGGATGTGTCGGGCAAAGGACTGCCGAAGAACTCGGACAATGACCCGGATTTTCAACGCAAGCAGGT
GCGCTCGGTGTGGTGGCCCATCCCCCCACCAGGATACGTAGCGTTGGGTTGTATCGCCGGTACGAAAGAGGATCCGTTCCAACCGCCGGCGCTGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTGTATCCGCGAAGAACTCACGCACCGAGCTGAGTCTTACAGCTGCCGCTGGCGCGCCGGGACACG
GTCTTTTGGTCCGCCGACGTTACTCAAGGCACTCGACCAACTTGGCGGCATGGACCCGAGGCGTAATCAGCAGACTGAGCAAAACGGCATGAGCATGCTG
GAAATGGCGGCCGACGAAGTGTGTGTGCGCACATCACTCTGGTCGGTCGACAGCGAGTTCTGCAAGGCGATCCTCCCAGTGCTCTCCGTCGATGGCGAGG
CATCCCAGGGCGCGACTGCCTCGACGATCCGTTTATCACAGGAAGACAAAACCCTGTGTTCGCCTGTGAGTGCGCACCACGCCATGCGGTTTGTCGACGT
GATCCTCGACTGCCACCAGTCATCCCTTTTGCCGATGGACAGCGCGCTTCGCCCCGAGCTTGCGGCAGCTTTGTTTGCACTCGTCAAGCAAGTGCTGGGT
GAGACCCTGCCGGGCAGTGGGCCTACGGCTGTCGTACTGGTGCGCGCGCTGATCTGTTTAATTCAACAGGGTGGTGCCTGGAACGATAAAGACGGACTCC
TCTACTGCCGCTCCAAGATTCTCACACTCCAGCATGAACACGAGAACGGTGGCGCACTGTTGTTGCCGTCTCTGCTTCAGGCGTTTGTCGAGCTCATGCT
AGTGGTGGACGAGGAGACCCGTGGCGCGCGCGTACAAACGCTGACATCGTATTTAGATCAAGATGCGAAATCCTCGACGATTTACTTGCCCTATCGGTTC
CAGTTTGCGCGCGCTGATGCCCACAAGGAAATGCTCGTGAGCCACTCGTCCAAGATGATGGTCACGCGTCACTTCTCTGGAGAAGAGCGCAAGTTCCTTT
TGGAATACCACGCCGACGATACGGCCCAGCCAGGGGGAGATGCGTCGTCTGTGGAGCCGACCGCGTCCGAATGCTTTTCGTGTCGCTTTGAGCACACACC
CGAGTTGGTCATGACGCTGAAAGACGAGCTCAAGGCCGAGATCGTCTACTTTGAACTCACGGTGCTCGAGTGGACCAGTACGTTGTCCACCGTGTTTGGC
TTCGGCTTGTCGCCGCCGGAATTCCCACTCGAAGGACCTGTCGTGGGGATGGCAGCTAGTGGAGTCCATTCTTATTCCTTCACGCCCGTGACGGGCAAGG
TCCATTCCAGCCACGCTGGAGCCGATCACTGGCGCTGGAACGAGCAGCAGCTCGCAGCCGTGGCAATCGGCGACGTCTTCGGCTGTGGACTGCGGCTCGA
CACCCGCGAGGTCTTTCTTACCAAGAACGGGCGGCTGTTGGGCACGGCATTTTCGTCTGTGGTGAATGTGCGCCATCTTCACCCGACCGTCTCCGTGTCT
GGTGACTGCAAGTTCCTGCTCAACTTTGGCAACTCGTGCAGCTCAATCAGTGGCGACAACCTGAGCAAAGTGAACTTTGCGTTCCGGTTCCACACGATGG
AATACGACAGCCTCATGGGCGGGCTCGAGTGGTATGAGCCGCTCAGCCAAGTGTACGGCGTCATGAAGGCGCTGGTAGATCCTGAGCGGGACGCTCATGG
AAAGAGTGGGGAGATGGCGAGGGGGGCACTGCTGCCGGACGAGTTTATGCTGTCGGCCGATAACTTCCTGTCCGATATTTCGCACGACGTGTGTCTACGC
GTCGAGAGCACGCACCCTTACGACCTCGAACTGCAAGAAGCGCTCGTGAGTATTCCTTTGGCGACGTCAATCCGCGTCAAGCTGGACGCGCAGTGCGAGA
CGGCCAACTCGCACTGCCTCCAGATTCTCCAAGGCGGCGATGGCGGCGGCAGCGGGGGCCCCGAGAGCAATGGCGGGAGTGGCAGTGGAAGCGGCAACGG
TGCCGAGTCGGAAGTACGCGCCTTTACGGGCGCGTGCGGCGGTCAGGAAGTTATGATCGACGGCGACTGCTTTGTGTGGCGGTTCCCCGTGCAGTCAAAT
TTTCAGTGTCGCGTCGACCGCGTGCGCAAGGGACCCTACCTCAAGCTAGAGAATCGCGATACGCGACTCTCGCTCTCGCGCGACAAGGGCTGGCAGACAG
CGATCGGCGTCGCACGGTTCGACAGCGGTGTCCATATTTGGGAGGTGCGCATCACGTTTGTCACAGCGAGCTCCAACATCTTTTTGGGGATTGCGCGCCG
CGACGTGCGGCTCGACTCGTACTTGGGCAAGGACAACCGTGGCTGGGGTTGGATCGGCAACCGCGCATTGTGGCACAATGGCAGCAAGCAACGTGGCACG
TATGGTGACAAGTTTAAGACTGGGGATGTTGTGCGACTCACGCTGGACCTCAAGCGCGGCACGCTGTCGTATGCACTGAATGGCAAAGATCTCGGCGTGG
CATTTGGCCCCGGTGGCGTCGGGCCTAAGCTCGAGGGCACGTTTTACCCGGGGTTTGCATTGTACAACCAGCGCGACTCGATCGACCTCATTGGCGGCCA
CCGCTTGGAAGACGGCGAGGCACTACCGGCTGGAGGAAGTGGCGTCGCTGGACTCTTGCCCGGCAGCGCCCTGGGCGAGGACGCGTACTATAGCGAAGAC
GACGATGATGCGCTGGGCGACAGCGTAGACGATACGACGATCCCGAACTTCCGAATGGAGCTGGCGACTGCACTGAGTCTGATGGGGTTCCCCATGGACT
GGTGCGTCTATGCGCTACGCCATTGTGAAGACGACGCCGAGCAGGCAGCCGATTTCATTCTCTCAAACATGCATGTGATGGAGGCACTTGTACGCGAAGA
GGCCGAGGCCCAAGCTCGCCGGCTACGCCACCGTGAGGCACTGGCTGTGGCGGCGGCAGCTTCCGCCGCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNTC
GCCGACCCGAGCGAGCGAGGGACTCTTTGGAGGAGGCTTAATACCGGGGGATGCAGGAGACCATGGCGACAGCGAAGAGTTCATAGTCTCTGGAAGTGAA
GATCCATCCAGCCAGTCAGCAGCCGACGGCTCCACACCACAGAGCATCGACAAGTGGGGCATCGCGTTCACTGCCGTGCCCGAGTTCTCGGTAACAGGGC
GTCGCCTACTCGCGTCCAAGTACGCTAGCAAGCTCCAGCAGCTCCGCCAATCGCAGGCCGTGTTTACCGCCGACCATGATAATGCGATCGTCCAGATCGT
CAATGAGATTTGCGAATCCCGTGCTGAGGCGTTGCTGAGTTGCGATCCGCTGCGCATGGCACCGGAGGACTTCGTTCCAACCGACGACCACCTCCACAGG
TTCCAGTGTCTGGACGGACTGCCGCTCGCGCAGCTACAAAAGCGTTTCCTTATTTTGCGCAACTTTAACTGCCGCCTCCAGAACTCGCTGGCGTTCATCG
ACTTATCGGCGAGCGATGACACGTCGCTTCTCGCTCGCGCGTCGCGGCAGCTGCGCGGCATCATCTTTCAGCATGTCAAGCTCGCATGGTGGCTCAATCT
TCTGAAGGAGCAGCAAAGCCCCGCGGCATCGCGGCCTGAGATTGAAGTCGACCGCCACCGCGCGCGCGAGGCCACCCCTGCTTCGGGGGCTAAAGACAGT
GTCTTTGCGCAGTGCTTTGACCAGCTCCACTCGCTCCCACCGTCGCTCTTGCGCGGCGCCGACCGCGCGTTCAAGTGCCAGTTCGTGGGCGAGTTTGGTG
ACGACTTTGGCGGTTTGTATCGCGAGTGTCTCGCCCAAATCAGCTCGGAACTGCAGAGCCCTGTTCTGTCAGTACTCACGCCGTGCGCCAACGCGCTCGC
GTCCGTGGGCGACCATCGCGACAAGTTTGTGCCCAACGTCCACTTGCGCATTGACGCACGGCTCGTGCACATGGCCGAATTTCTCGGCAAGCTCATGGGA
ATTGCGGTCCGCACGAAGACGCCGCTGGACCTAAACTTGCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCTGGTCGCGC
AACGCGTGGTGCGGCGCGACGTCGAGTCAATCCACGATGGGTGCTTCCAGGTCGTCGATGCGATCGACCATCTGCAAACGCACGGTATTACTGAGATCAT
GTACGATGAGATTATCGACGCGCAATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGCGCGTGCAG
TGGGACGACAAGCACGATTATGCGCGGGCCGTCGAGGCCTATCGACTCTGCGAATTCACGCCGGTCTGTCGGGACGTGTTGCGGGGCCTCGCGACCATGC
TGCCGGCGCCGACCCTGGCATTGTTTACGTGGCACGAACTGGCGACGCTTGTGTGTGGCAAGCCCACGGTCGACATGGAACTGCTTCGCCGGCGTACAAT
CTATGGGGACGGGTGCCAAGCGAACGACCCGCACATTGCGTACTTTTGGGAAGTCCTAAATGAGTTCACCGATGAGCAGAAGTCGTCGTTCTTGCGGTTC
GTGTGGGGCCGCTCGCGGCTTCCGACCCACGCAGCCGACTTTACCCAAGATTTCAAGATCTCGGGGCTCCCCAAGGCCGCGGGCCGACCCGACGCGTACC
TGCCGATCGCGCACACGTGCTTCTTCTCGATTGACTTACCGAACTACACGAGCCGCGATGTCACACGGGAGCGGTTGCTCTACGCGATTACGCATTGCCT
CTCGATCGACGCCGACAACACGACGGTCGCGCAGCGAGCTGGCCAGGGCCTCAACTGGACAGCGGCGGCGGCACCGACGCCGATCGCCACCGGAGCCGCG
ACTACGACGAGCGCGACGGCCACAGCGTCGGCCATTGCCG