Description :
From Genome Similarity Track
Location :
Scaffold_2833:1006- 2195
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2833-fgenesh-gene-0.0Amino Acid-Polyamine-Organocation (APC) Family
Pytir_DAOMBR486maker-pir_contig_2833-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
1189 bases(100 bases per row)
TGCCGTTCATTCCGATGTTCTGCATTTTGGCCAACTTCTACCTGATCTCGCAGATCAGCCACCTCGGTCTCGCGCTCGGCTGCGGCTGGGTGGGTCTCGG
CATCTTCTTCTACGTTATGTACGGCTTCAAGCACGCCGCGGGCCGCACAGGCTGGAGCGAGCTCATGCGCTACCATCTACCGAGCATGGACCATCAGGAC
AACTTTGCGCCGATGCTCACGATGAACGAAGTGCGTCCATCCATGTCGTCGCTCATCAAGGAGAAACTTTAATCTAATAGAGTGTGAGAGTGTGTGAGAG
AGAAAAGGATTTACACCATTTTGCACCATTCTCCACCATAAAGAAATTTATTAGCACCATCCTACAGTAATATGTACATTTTGTTCCACTCGATATTAGA
GAATTCGGAGTATAATAGGTGATGCATTTGAACGCACGCACATACATACACAGACGCTTATTTGTTTTGGTGGTTGATGAACCGCAGCGCGAGCAGGCCG
AGGATGCGGATGAGCACAATCGCCACAAGCACGACTGCAAAGTTAGTCCAGATCTCGTCGTGCTTGGCGTCAAAGATCGTCTCGATGTACTGCTTGACCG
TCTTTACGGGCACGTTGAGCGGCACGCCGATCATCTCCTGGCAACCCAGGTGGTCGCTGCGCGAGCTCTCGCTCACGTCGTCGGGGCAGTCGGCAAACAC
GATCGCCGCTAAGATCGAGAACGAGTACCGCTTCGGCACGACGTAGTAGAGCCACTTGTACGCCGACGGCAGCGCGATCGTCGGCGGGTTGAAGCCCATG
AAGAGAAAGAAGATCGAGTTGAGCAGCACGCCGATGATCATCGCGAGCTCGGCGGNNNNNNNNNNCCCGTGTATGTCTGCATGAGGATGAGCAGCGCCTT
GTTGATCCAGTAGAGCACGCCATTGGAGAACCCTTTGAAGCCCACGAGCGGGTAGAAGAGCACGGTGAAGATGAGCGAGCAGAAGAACACGTACGGCACT
TCGGCGACTGTGATGCCGAGGAAATACCAGAGCGCATTATACGTCTGCGATGCGCGCTCGCGGTAGAACGCGCCGCGCTCGTTGATCGCCACGGGCAGCA
CGCTGAAGAACGACACGATGCCACTGAACACCGTGGAGAGGAAGACCATGCCCAGGCCGGCGTTCACGCCCTGGTACGTCTTGTACTCG