Description :
From Genome Similarity Track
Location :
contig_42:100594- 102708
Transcript NameFunction/comments
g7696.t1hypothetical protein

Sequence
2114 bases(100 bases per row)
GAATTCATCATGTGGTAGCCGGATCGGGTATCCAGCTCTTGCTACTCGAACAGCTTCCATCACACCGTTGCAACGCAATTGGTTCAGCACACGCTCGCGC
TCGTAAATCCCTGCCTTGCACAGTTCGTTTGGCTTGAGGCATCGCACGTAGTGCGGGTTAGTCTGATGGAGCGTTTCCAGCAACGTCGTCAGCTGCTCCT
TAAACTGAAGACCGACACTTGCACCTCGGTGCTTACTGGTTTGCGCCCGCTGACGCGGAGAGGATTTGGCGCGGTCACGGGAACCTCCAATGCCCTCGCA
TAGTGTCCGCGCAAAACTGCCTTCTCGAGTGGAATACACGAGCATATCCACAGCCTCCTGGTGGAGAACATCCTTATTCTTCTCTAGGAACCCGTCCGAA
GAGTATTCTACGTGACCCGCATAGTGTACAATCGTAAATAGTCCACGCGCTCGCTGGATTCGGGATGCCTCGAAGCGCGCGTGGCTACCGCAAGCTCGGT
AGAGCTTCGATGCCAGCGTCGTGTCACTTCCTTTCGGCATAACACACTCCTCATCGATGAGCGAAAGGATACCTGTCGGCCGCTGCGAAATTAGGTTCAC
GCAGTCCTGGTTATCGCAGAACTCGATGTACTTCCAGTCCACGCCCTGGACTCATACTCGCGCTGCTCGGCCTTGAACACGTAGTCATTAAACTGCTGCT
GCAACGTCTCGTTTGCAAAGTTGATGCACAGCTGCTCAAAAGAGTTCTTCGGGAACACTTCGAAGCCGAAGATATCCAAGATGCCGATAAAGTGCAGGCC
GCCCTTCGCCTTCTGGCTGTCGTCCATCTTGAGAAAGTGGTTGATCTTCGTCACCATCCAGTCGAATAATCGGCCGTACAGCGCCTTCGCAAGAGCATCG
CGAGCGTTGTTGGCCTGAGCTGCGGAGAGCTTCATGCTAACAAAGTCTGTACCAGCACGAATTCGGCGTACACTCAGCGCTCGCTCCAGCTTGGTCGCAT
CCACAGCCATGAGCGTGGCTGCCGCATCGCGTGACCAGATGCAGCTCGAAGCCAAGTCCGACTTGCCAGCACCGGGGCCCATCGACTGACCCAACCTGTC
GCTGTTTTCATCGTGCTCGAAGGACAAATTGCCAATGTGCATGAGCGCCGCCAGGATGTCGAAAATACCTGCGCGCTCAGCCGGCGTAAAGCCCACGATG
TCCATGGCGTCCATAACTCGTCGGAACATGTCCGAGTCTTTGACGCCGTCCCGGCGCTGGTAGCACTCGCTCTGGTTCAGGTAACGGTAGTGCAGGAACT
GCTGCGTGGCATCCGTGACTTCGCCGTGATCACCAGGAGGCATCGAGTGGCCACTGGGCGGGTCTAGGAACCAGCGCTTACGAGCCGCTGGGGCAGCTCC
GATGGCCATTTCGTAGAAAATGTGGTAGTTCCGCTCGCCCTTGGACTGCGACACGAGACGCACCTTCTCGAGCAAATACGTCTGGATGCTGGCGCCGGTG
AGTCTCCCGCCGCTGGTAAAATGCAGCTTGATAAACTTGCCGAAGCGACTGGAGTTGTCGTTGCGTAGTGTGCGCGCGTTGCCGAACGACTCGAGGAGGA
TGTTGGTCTGCAGCACTTTGGCCGCGATGCCCTCGGGGCTCTTGCCCGCCACGGACGCCGCCAGGTTGTTGGCGCCTACTTGGGCGAGATACTCCATGAG
GAACTTGGTGCTCTCGGTCTTGCCGCTGCCGCTCTCTCCACTCACGAGGATGCTCTGGTCGCTCATGACTCCGTTGAGGCCGAGCATCATGGCCTTGTAG
GCTTCTCCCGCGACTTGGTAGATGTGCGGGGGCATGGGCTCGCTGCCTTTGTTCCTGAGGGACGAGCTGCGCGCCTCGAAGGACAGCAGGTACTTGGCCA
TCGTGTCTTTACTGTAGATGTTGGGGATCTTCTGGAACGGGTTCACAGCCAGCAGGATGGCGCCCGTGTTGGTGTAGATCTTCTGCTGGGCGAAACGCGT
GTCCAAGGCGCTGAGGATCGACGTCTCGTCCAGCTCGATGAGCGTTGTGAGGTCGTCCACGTCCACATCCTGACCCTGAGAGAGCAACCGCACGTCGGGC
GCGTCCTGCGTCAC