Description :
From Genome Similarity Track
Location :
Scaffold_219:10058- 12572
Transcript NameFunction/comments
Hyaar_Emoy2812808PREDICTED: E3 ubiquitin-protein ligase TRIM39-like

Sequence
2514 bases(100 bases per row)
TGTGTCAAAAAGCCGAACAGCAAGTGGTGTATTGTGCATGCTTATAACAAGCTTAGTGCGGCTACGATTCATGCACAGACACCCATTCCTCGAAAGGATG
TTCTTCAAAATAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTCGATGGATATTATCAATTGCTCATGTGAGCGAGTGATATTCTGCTTAC
AGCAGTGAGCACTCCGAGTCGCATGCTATGGGAATGGATGGTGATGCCCCAGGGGCTGTCTCATGCTCCGGCAACATTTAATCATATGGTGACGCAACTT
TTCCGCCTCATCAGTATTATACTCAGACATACTTTGATGACATTTTTGTCCATAGTCCTGCCGAACAAGGTCGGTTAGATGTTGACAACCACATCGATCA
TTTGCGATCCGTGCTTGAGTGCATGCGCGCTAATAAATTGTACGCCAACGCGTCTAAATGCAGTTTTGGTGCAGAGGAGATTCCTTTTCTAGGATGTTTC
ATTGGTAAGAGCGGCCTTCGAGCGGATCCCGCTAAGGTCAAGGCTATAGTAGACTGGTCGATTCCTAAGAATCCAAAAGACTTGCGTAAGTGGGATTGGC
CTTGCCAATTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACTGATCTCCCTAAGAAGATACAGATTGGCGTTGGGACAACAC
CCATGCTGACGCATTTCGGGTATTAAAGGAGAGTCTCCTCCATGCTCCCATTTTGTCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGCCTGCGATGCA
TCAGATTTTGCTATAGGCAGCGCCCTGTTACAAACAGATGCTACAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTGCTGAAAATA
ACTATCCAGTTCATGACAAAGAGCTAATTGCTATGAAGTATGCGCTCGTCAAATGTAGAGTCCATCTGCTTGGCTACAAGCCATTCGTCGTCTATACGGA
TCATGCGTCATTACGCACGGCGACACAGTCGCCTCACCTCTCTCAGAGAATGGCTCGGTGAATTTCCTTCTTTGCGTAATATAACTTCGAGGTGAAGTAT
AAGCCAGGCAACCAAAATGTGTTGGCAGATGCCCTCTCTCGACCTGATTATGAGCTTGCTCATGTCACGACTTTATCGTCTCCTATTAAGGAGTTAATTC
GTATAGCATATCCACGGGATTCTCAGTGTGTGGCATTGCTCCATGCCCTTGGGAGTGAGGAATACAAAGCCTTGGACAGTCAGTTATCGCCACGGCTGCG
TCTCAGCCTACATCGATTTTCCATCGATAATGGTATCTTGTGTTATCACAAAGATGTAGCGGATACCGCTCCCATTGTTGTGCCTCATAATGAGGATTTA
AAGTATTGAATCCTCTTTGAGAACAACGATACTGCCCTCAGTGGGCATTTGGGCCGGGAAAAGACTTATGGCTTTGTGATTCAACACTACTGGTGGCCAA
AACTCTACAAATGGGTGAGCACATACGTGCTTACATGCGAAACGTGCCAGCGTGTCAAACCCTCAGCACATTCGACTGCGTCACTCGCCAGTTTACCTGT
GGCCACGGGATGTTGGGAGTCCATCAATATGGATTTTGTGTTTGGTATACCTGAAGACTATGACGGCAATATGGGAAATGTGGTCTTTGCTGACCGTTTA
AGCAAGATGGCTCACTTGGCGCCGGTACCGGATTCCATCGATGGCAAAGGTACAGCTATCCTGTTTATCGATCGTGTGTTCGTCAACACGGGTTGCCGCT
AGCAATCATCTTTGATCGAGACCCTCGCTTCACAGGCAAGTTTGGACTTCCATCTTCAAGGTATTTGGCACGCGATTGGACATGTCCCACAGCGGATCAT
CGGCAGACCGATGTTCAGACTGAGCGAGTTAATCGCGTCATTGGCGATGTTCTTCGCAGTGTTTGTGCTGAGTCGACTAAGACTTGGAGCTCGATGCTCC
CTGTCATTGAGCTTGCGTTGAACAACGCTGTTCATGCCTCGACCGGCTTTACTCCCTTCTATGTGAATAGCCTCAAGCACCCCCGCGTTCCGCTCACGTT
ACCACTACGTGGTTCTGGGCTTGGTGGGGGGGAGTCTGCTGGCAAGCTTGCTGAAATCAGCCCTACCACGATGCAGACACAAGTGAGCGAGTTTCTCGCG
ACGCGCTTTAGTTTCTCACGACATGTGCGTGATGCAATGGCTGATTGCCAATACAAACAAAAAGAACAAGCCGATGCTAAAGGCAGAGGATGTATTGATT
TTTATGAAGTTGGAGACCAGGTCTTATTAAACGATAAAACCCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACAAAATTGCGTCCGCGCTTCATTCG
GCCGTTTACGGTCATAGCGAAGAAAGGCCTTGACTATTCACTCAATCTCCCGCACAAGTTGCGCACACACCCAGTGTTTTACATTGGCTTGCTTAAGCCA
TATCATGATCCTTA