Description :
From Genome Similarity Track
Location :
Scaffold_58:10056- 15939
Sequence
5883 bases(100 bases per row)
CGGCGGCTGGTATCGGTACGATGCACGTAACCCAAGTGGTTTGGTGTGGCTGCAGATCACGTGTTCGATACCAAGTGCGGATGTTAAGCCTTCGGGACCT
GGTGTTTGGGGTTCTCCAGCACTATATTCTGCCAGACAGTGACGTCCCCCACTTATGGTACGTTTTTTTTTTTGTTAGTATTTTTGAGCGTTGAAGCGAA
GATGTTACTTGTGGCCGAAGCAGAAAAACCAAAAGTGAATTGCATGATGTGTGTTTATCTGTTCCTACCGTTGCTACCGTTGTAGCTGAACATTCCTAGA
ATCACTCGATGTCGCTCACTGTCAATGCAGTTGTCGCAGCAGTTGTTGTAGCTGAACATTCCTAGAATCACTCGATGTCGCATCCCCTTTCATCCCTTTT
CCAGGAAACCCTTTTCATGTCGATGTGGGTGATAGTCACAAAAATGGGGGACGTCACTGCCTGGCAGGACAGTGCAGTTGAACCCGAAATACCAGGACCC
GAAGGTTTAACTTCCGTCACCGGGTATCGAACCGGTGACCTGTGGGTTAGCACTGCCATACCGTACCACTTGATCTATCGAATGATATGCGTGAAACTAA
GGCTTTCAAATCTATATTTGTCTCTACATTGCACACATACATGTACTTACAAGAAGGCATACGCATCAGCGCATCATTTCAATCAACAGTTTTATGTTTA
GAAACGTACATCCAGACGATCAGTAATGTGCGACTAGATGATTAGTAATGTGCGACTAGACGATTAGTAATGTGCGACTAGACGATTAGTAATGCGCGAT
GTGGCGATTATTAACGTATAGGCAGAATCCAGTAGGCTTAGAGTAACAACAGGAGTTTGTGAACTAAGGACCTAAATACGTTCACTTTGCATTTTACCAT
CAAGTGCCCAGCAACCTTCCTCTTTCCAATACAAACGAGCATTTGTCACGCTCTAAACTTCACTCATCCGTATCCGAGATACCCATGTCGTCATCTGAAA
ACACGTTGGAGCTGTCTGGTAGCCCAACAATATCATGATCTGAAAAAATTCACTTGGCTGTCATTCTCATAATTATTCGTGGAATCAACGACGTCTGCCC
CAACCGTTTGCTGGCAAACCTGGATCACTGTCAGCATTATTTTCAACTTCCTCCATTGCTGAAAAGTTTATGTCTGCGATTCTTTGATCCGATTGGTGAT
TTTTCACATACGAAAAAATTGACCTCGACTCATCTGAGTGCTCAGAAGATCCATCCTCTCCGCTCTCTTTTTCCAATTTAAATGAAGCATGATAATATTT
AGCGTTTGACCTTTTAGAATCTCTTTGCGCGTCAAGCTCTGAGGATTTTCCACAAATTTCCCATTTTAATAACAGCCGGGATAGTCGTTGTGTGACACAT
ATGTGTTCCTCCAGTAGACTTATCATCCGATTCTCCTCCTTCGTCAGCTGTATTGGAGGTGGCATCTACATCCATATTGCTTGAGATATCACAATCGTAT
CTTGCATCGCTGTCACTGATATCGCTATTCTCATCAGTCCAATATTCAGAGCTGAGTTCTGGACATAAGTGCATTGAACTTTGAAAATCACGTTTTCATC
AAGTCTTACGTGAAAATCACGTTTTCATCAAGTCTTACGTCTACAACGTATCGGGTCGTGTGAGGTCCAGGTACATATACCTGGTATCAGACGTGTCTTC
ACGATATCCGAGCACATAGCCAATAGTAGCGTTATGACTATACTTTCTCCGCTACACCCATACAGTAGGTGTATTTAGGCATTTGCACTAAACGTTCGAA
CGTGGTGCACGTCCTCGTATGAGTTATTTTTGGATATATTGTAATATGTGCAATTCTCCAGGTACGCAGCAGTACTCAGCGCGTTTACCCATAATGACTT
TGGGAAACCGGACTGCAGCATCATTTCTTTGGACACCCCAGCAATGCTTTGATAAGTATGCTCGTACAAATATCTGGTGAGAATTTGGAGGAACGGGACG
ATGCATGATACCCTTGTTCTGGTACCATCTTTGCATTTTTCGTTCGTTAATTCTGACTCGTTGTCCGAGACGATACTTTTTACGTTCTTCGATACTGTAC
GTACAGCCCATATATATTGGTGCATCGATGGGCTTACTTCTACAGGCTAAATTAATATAACAGTAGAGAATCGATCTCCATTATTTCTTGGTGGAAATAG
CAGATCGGCAGAAATTAAGTCATTAATCCGTTATAATCCTGAGCCAGGGACGTATTTGCCGACTTCTGTTTTTTTAGCCAAGTGACAAACTTCAAAATTG
CTAAACGTGCTATTCTTTAGCATCACCCCTCCACAGGGCCGTGGTAAACCATAAGCTTGCAGTAGATTGGACCCAAATTTTCAGGGGACCATGCAATTTC
GGTAGACCCTAGACCCCATGAGCCTTCGTATATAAAATTCGCTTTTCTGTGTCTTGCAGTACCGGATCATGTTGTCATATTTTTATGGATCCTGATGATA
GTCGTAAACCTTTATCTTCAGACATGCTTCGTACCAACATACCTTCGTGGTTCATTGATGCGCTAATTGTCAGACACACGGATCATTAAGATTGGTATTG
TAATAAAAAAATTGTGTCACAGCGTGGCAATTCGTCGGTCAACCTGCTTACTCGAAACGATGACAACCGTACTGCACGTCGGCAATGTGCTGAATAGTAT
TTGTATCGGTAATAAAGGGCTGCTGCAGCCTTGGATGCAGACCCTTGCTGTAACACCAAGGATTTGATGCAAATCAATTAAATTATAAATAACTCCGCTT
CACATTGATACCCTTGTTCAAACCATTTCTTTTCGAGCTGGAAATGCGTTGATAGATGTAGTTGTGCCCTGTCGACGTATAAGACATCGTAATAATTCTT
TTAGCGATGTCGTCACCAAATGTTGACTTTAGCTCCACGCACCAAAACCTTTCGGTGTTGTCAAAAATCCATAAGCAAATCCAGATATACTTCTCTGCTT
GGCGCGACTAAACGTTTCGTATGAAATACAGATCGATCACATGCGACATGAGCGTTGCTGGCACTGTCCAGGTACTAAGCAGGTGCCTTTGCATATTCTT
TTGTTTCTTCAGTTGGTAATATATAAGCCTGATCTTGAGTCAGTTCTCCCGCTTGCATATATTTTCTTTTTACATGGAGTAGATGATCCAATATCTTGGT
ATTCCAGCATAGCGCCATTCTCTTTACTATTTCTTACTTGACGCTTAATGCCGGTAGACGGTCCTTTGCCTTTTGGCTCGGATTTCTCTTCTATCTGCGG
ACATTTTCTTCGCAGATGCCCAGCCTCATTGAAGAACCTTCGTCCTTTCTTTATAATATCACTCTTCTGTGATTTCTTGAAAATATCGGCCTGCTTGCAA
TCAGCCTTGCTATTATCGCCGCCTCGATGATCAGTTCACACCTTCTGCTCGCTGAGCACAGTAGAGAACTCTAATCGCGTCCCGGAGCTTCTCCGGCGTA
TCCACGTGACCTAAGGCAATCTCGACTCGATATCCAGTGTCTGATGCGGTTCGTGTGCGGAAGACTTCTCATTAAAAATTAATTCATCTGGTAATTCGTT
AACCATAGCACTAACCGTAAAAAGGCGCTCGCGAAGGTTTTACATGTAAGCTTGATCTACTTCAATATCCGAACCAGACAGAAACCGATGACTCTGCAAC
TTGTCGTACGCAATACATATGTTGATCGACTTCGCCTTACTGTTCTAATATCAAAGTATTCTACAATGTACATCCACATTTCCATTCCGGTACTCATCCC
GTACAGTTTTGGTTCCAAGTCAGCCGACAACGAACTCCGTCGCTTCAGCTTGATCTGCATCTAATCGTAGTCCCTTATTAATTTTTCGGTCTGCAGACTT
TAGCGGTCGACTTCAGCTCTTGTGATCGCATCCAGACTTTCTTTTATTCGCTGCGATCATGAAGTGATTGTAAAGCATCATGCTTCCCCGCTCCAGTTCT
TTGGAAGACCTGTCTTCTCCCGTATACCGACCCTCGTTTGGGAGCTGCTTGCTAGTTCTTGATTGGGCTCATTGCCCGGTCAGGAATGCAATGATAGTTA
CTCATCGAAAATCGTCGGTGTACTTTCCGTTTATCCCTTTTTCCTTGCCTATCCAAGTTCCGACTGATCCAGAAAAACTTGCTATATCCTACTGTTGGCA
ATATATCTGTAGATAACTATACGCACTACAACTATATGTATCACATACCGTCCAGTATCCCCTGCGTGTATACATACCTCTCCAAGTAATACTGGGCTCA
ACGGTTGTCTGGTCCGAGCCTAACGATTCCAATTAACACATAACGTGCACATATATCTTTCTAAGTAATACTAGGCACAACCATTGTCTGAATCGAGCCT
AAAAGATTCCAACAAACACATAACGGGTGTTTTACCAAAACAGTATACCACATATATAAATTGCACCCGCAAATTTGTGGAACTGTTTAAGTAGTAAATT
AAAATGACATTACCTAACGCAGAGGGTAAGCCAATTTTCTCATATGATGATGGTGATAATTTCTCAGAAACTCAGAGTAATTCCAACTTCACCAATATAA
ATATTTTTGCGATAAGTATGCAAAATAATAATAATAATAATAATAATAATAATATATATAAAAAACCACAAGATGTCAAAAATAAATACCTAGGCGTATA
CTATGCGTATGACATGACATGATCTAGCACCAATTGAGACTCCAAGCCAATTGTTAATCTTTTGTAAATTGTAGAATGATAATCAAGCGCACAAAAAGAC
GGATCACAGTTTTGCTGGTGACAAGGTGTCTCTCAGCAGCTTTCGCCAGGATGGCCAAGATCCAAGGTGAGCTATATTCTGACCTGAATATAACTGGAAT
AAAATTCGAGCAGAGTAATCAGTTTTATAATCCTAAACTAAATCCCGTGACTAGAACATACATATTCCAAGGTAAGGTGACAGCTAGGTATCGGTGTACT
TACAGAAATCAACGTAAGACTCGTCGTGGAGACCCAATTTTATATATTCTTGCTTCGGTGATGCTCGATTACCATGCTGAAGGGTAACAAAGCATTGTAC
ACATACGTCTGGGTGTGCGACGACCGGATCATTTCTCGATTATATTCACGATTGAACGCTATAGACGCCCGCGCGAAAGTCACACAACTTGAGCCTATAA
CGGCGTACCAATTATTGTAGAACTCCAGTTTTACCGTGCATACGTGCTATTTCCTGTATACATAATAACATCAGTTCAATATCCATTGTCCATCATCCCT
CAGATTCATTATGTTACAAACGATTTTTAAATATAGGTTTTAAGGATAATCTAAGTTCGCTAGCCAAAAACCGATCCGGCACTTTCTCGACTCAAATGAC
CGATGGTAGGGTGACATACCAATAAAAATACCAATCTATACGGATGTCGTAAAAACGTGCCCGGGTAGAAAATGAGAGCTAATACATACATCTTCAAGAA
GCTGATTAATGTACCAGTCTCCAATATTGCGCTCGTATATTAAATGCCCATGTCATTGGTCATCTCGAAGTCCAGTGCCGCAGATCTTGCCCATCCTGGC
AAAAGCTACTCAGAGGCGCCTTTTCACCAGAGAAAAAGAGATTTGTCTACTTGTGTGCTTGCTTATCATTCGACTGAAACATATGGTCAATATTTATCTT
GGAGTCATAACTAAAGTACTAATAACTAAATTCTGTTATGCCATACGTATAGTATACGCCTCGGTATATCGTTTGTTCCTGTTAAAGTTGTGGTATATTC
TCTTGTTTTTCAACTTTATTTTCATATTTTTTATTAGTTGGCGTCTAGATATTTCTCATCTTATTGTATACTTCCGCTTTATG