Description :
From Genome Similarity Track
Location :
Scaffold_13:10054- 11365
Transcript NameFunction/comments
Hyaar_Emoy2802400endo-1,3(4)-beta-glucanase, putative

Sequence
1311 bases(100 bases per row)
TCTTCATGAAACGAAGCCGTCGGTAGGGTCTCTTGCATCTCCCAGCAGCTGCCGAGTACCGCCGTCATATTCGATTTCAGTGTACGATGCCCAAACTGAC
CCAGTACCTGGACACTGCCAGTATCGGTCTTCATTGTTGCCGCATGATGCGGGTTCGCCATCATAAGCAGCTCAGCGGTCGAGTTAGCGTCTTCACTCGA
CTCACCGTGATCGTTGAACCGCTTCGTTTCCCAGCAAAACGAAAACGAAGCAGTGACGTCGTTGACATCCGTCGAAATTGAAGAACCTACTGGGTACACT
CCAGCAGCTTTATCCAACACAGTCACTACATCCTGTGACGCTCCTTGTGGGACAATCGCCAGTCTTGCGACACCCGTGTACAAGTCCCTGTCCACCAGTC
GAACATTGGTGGGGGTCGTCAGTTCCCCCCGCAAGTTGTACGGTCGATCACTCTTCTCGTCCGCAAACTGCAGCTGCAATGTCCGGACCCTATCAAAGTA
CAAGATCCACTTTTGCTGCGACGTGCCCATTCCACGAGCACTCACCCCCGTACCATAGACTTCCACATCCAGTTCAAAGCGCTTGCTTGTGAACGTTGGC
AAGTCTTTCCACGACGTCATCACACCGTAGTCCACTTCTTGGTCCACTATCTTGCCATTAATGACCACGACCGTCGCGTTCAGCTCCAGCACGGGCAGCA
CGTCATGGTACTCGACCGTAATGTACGGCGAGCCCCGGACGAGAGGCACTTTCATCCACTTGTTCTTGCTCACGTAATCATATTGCAACGTGACCGACAA
GACGTCAAAGGCCACAACCCGTCTGGACGTGCTATTGCCGTGTCCTAATAGCACCAATGGACCCGCTGCTGCCTGGTCCTCCAGTGCCTCATTCTTGTGA
CTGTAAGCCGTGAAGCTCGCGTCGACGTTAAAGTACTCAGTGATCGCGTCCTTGGTCGCCACGCGACGCGAGTCTCCGTACGAGATTTCCAGTCGCTTTG
GCAAGCTCCGGACTGTATACGGACTTAAGGTGACCTCGCCACAGCCAGCATTCAACCCGTGACCGTCTGCGACAAGGAAGTTCGACCAGAACGCGTTCGT
GGGCAGTGATTGGCCAAAATGCTCGCGAGGAAGCACGAGCTTGGGCGGCACGGGGTGGCGCTTCTCGACAAATAGCGGCCGCATTGTGAGCAGCTCAATA
GTAGGGTCTACTGGACGGGATGTCAACTGGGAGGTGTCTGGTCGGTGGCTGCGGAAGAGGAAGCCGGCGGTGACAAAGGCAGCAATGAGAAAGACGGACG
TAAGAGCGTAC