Description :
From Genome Similarity Track
Location :
scaffold_77:10051- 11420
Transcript NameFunction/comments
g2883.t1 hypothetical protein PHYSODRAFT_499448

Sequence
1369 bases(100 bases per row)
CGCAGGGGCTCATCGTGCTGCTGTGTCTCGTGAACCTGCTCAACTACATCGACCGGGGGATCATCCCGGGGGCCCCGCAGAGCTTCCGCCACTTCATCAC
GTCGTCTCTGGGTGTGGCTGTGACGGATCAGTCCGTGTACTTCGGTCTACTGTCTTCGTCTTTCATCATCGGCCACTCCATTCTCTCCATTGTCTTTGGG
TACTTCGCACTCACACACCGTCCGTTCCGAATCGTCTCACTCGGGACGAGCATCTGGATCGTGGCTATCATCATCTGTGCCATTTCCGAGCACGTCAACA
GCTACGCACTACTTATCGTTGGTAGAGTGCTCAGTGGCGTCGGAGAAGCTTCGTTCCAGTGCGTGGCGCCTCCGTTCATCGACCGTCACGCCCCGCCGGC
GCGTAGAGCGTTCTACGTCGGGATCTACTTGGCGTCAGTTATCGTCGGCACCGCTATCGGATTCGTATACGGGTCGCTCTTCGCCGAGTCCGCTTTGACG
TGGGCGGGGGCGTTCTACTTTGAAGCCATCTTGATGGCGTGTCTAGTCTTCTGCTGCTTATTCTGCGTCCCGGATGAGCTCAACGTCGTGCCGCCTTCGG
ACGATGAAGTAGCGCTAAGGAAGCCGCTTGTGTCGACCAATGAGTTCGCCAGTGAAGTCATGTCGTTGTCGAGGGAGAGCCACGATACCATTGAGAAGAA
CGCGGGCGGATTGTCACCGGATAAACACGGAGTTGAGATGTTGTCACCGAAAGACGTGGAGGCCAAGCCCTTCCTTCAAACGTGGTGGGAGATCGTCTCG
GACGTCCCGTTCTTGCTGGTAGTACTGGCTCATGGCGCGTATACGTTCACGTTGGGCGTGTTTAACGCCTTCGGACCGGACGTGTTCATTGGGCTGGGGC
TGTTCTCGGACGAGACGTCAGCGTCGCTCATCTTTGGAGGAATTGTGGCTGTCACTAGTCTCATTGGCACACCCTTGGGCGGGTTTCTGCTTGATCGCCA
TACAAAACACACCACTGTGCCCGGTAAACGGTGCTTTGTCGCGGTCTCGTCACTCTTGTTCTACGTTACGATCGCCGAGGTGTTCGCGTTGATCATGTGC
TTCATATCGGACAGCAAAGGAGCGTTCCTCGCGTGTTTCACCATCGCCCTCTTCTGTATGTGCGCACTGTGGGGGCCTGAAATGGTCGCTGTGCTCGAGC
TGTTCCCGTCCTCCCGTAGGTCGATGGCCATCTCAGCCAACGCAGTGATCATCCACGTCTTTGGAGACGTCCCAGCGCCTATTGTCATGGGCGTCGTGCG
GGATAAGTGGGCGCCGAACTGCGGAACAGTGGAAGACGACGGCGATGCGGTTCTGAATCCGTTGTGCAG