Description :
From Genome Similarity Track
Location :
Scaffold_497:1005- 4737
Sequence
3732 bases(100 bases per row)
GGCTGTTTGGTTTGCAAGGGGCCACATTGGGCGAGGGACTGCCCAACTGCATCTGATGAGCAGAAGCAGGAAGTCCTGCGCGAGTTGCAAGCTCGCAGGA
CACAAAGAGATGAGCGCGCCAAGGCAATTAAGGTCGTGCGCGCTGGAGAAGGGCGTCGTGCATGCATCAACGGCGTCCTGGATGTGCCGTTTTGTCCTGA
AACCGGAGCGGACAGCAACATCATTTCTCGAGCTCGCGTGGATGAGCTCCGCGGTGTTGGGAGCGGTTTATAGCTGCAGGCTTTGGACCCCGTTGTGCAG
GTGCAAGTTGCTGGTGGCACTCACGTGGTCTGTCGTGACGCTATCACTCTGGATCTGCGTATCGAAACGGCAGCAGGACCCTTGCACCTCGCTGACGTGT
CGTGTCTCGTCATGGACGGCCACGAGGAGGAATTCTTGCTGGGTCGCAAGACCATGCAGGACATCGGGATCGACATCGACAGGCTGTTTGATCAACTGGC
GAGTGGTCACGTTGGCGATGCTGACGAAGATGATGTTACCCATGAGAGCCCGCAATTGTCTTTCTCGGTGGATGACGATGAAATCTGTGGGTACCTGAAC
AAGATGGTGGGTGCTGCTGGAACTGCAGGCTTTGATCAAGAATTGTTGAAAGACCTGCGCAAGCTGGTGTTCGAGTATGCCGATGTCTGGCGTGTTCGTA
TCGGTGCTGATCCACCAGCAGACGTCGAGCCACTGAAAGTGAGGCTCAAAGAGGGAGCCCAGCCTTACCGCAGCGGGACAAGGAAGTATCCGCCGGCGCA
GCGGAAGTTCCTGCGGGAATTTGTGATGGAGCTGGAGCGCCATGGTCTGGTGCGATATAACAACACCAGTCGATGGGCTTGTCCTGCGCTACCCGTCAAG
AAACCACACAGCGCCGAGTTCCGCTGTACCGTTGACTACCGTCCTGCAAACAAGTGTACTGTGCCACTTGCTGGCGCGACACCGAACCTGTCGTCGGCAA
CTCACAGCGTCAGGGGATCGTATGGATTCGGTCTTTTCGACCTCTTTAAGGGTTTCTGGCAGCTCCCGTTGAACTGGGACAGCCAGGAGATCTTCAGTTT
TGTTACTGAAGATGGCGTGTTTACCTCGACACGCGTGCCACAGGGTGCTAGCGATTCAGCGATGCACTTTCAGCTACATATGCAGCTTTGCTTCCAGGCC
ATGCTGTATCGCAGCATCCTCATATGGATCGACGATCTATTGCTATTCGCCCGCAGTGCTCAGGAGTATCTGGCTAACCTGCATGCTTTCTTTGAGGTGG
TTCGTGCTAGGCGCCTAAAGCTGAATGCGAAGAAGTGTGTGTTGTTCGGTACTGGGGTGCAGCACTCGCCCGACCGACTTGAAGCACTCACGAGTATGGC
ACTGCCCCCAACTGCTGCAGCGCTGCAACAGTTCCTTTGTGCGGCAAACTGGCTGCGGGAGTCGATGGTTGACTACGCCAGGGTTGTTGGTCCGTTGTAT
TCGAAGTTGGAAGTTGTAGTGGCACAGCGTGGTAGACGCAAAGCGCAGCTTGCTGGCGTCGAGCTTACCTGGACTGCGGCCGACAAGGTAGCGTTTCGTG
CAGTGATCGACAAGTTGGCCACGTCATCCAAGTTGTACTTCCCGGACCCGGAGGCAGTTGTGTGCATGTTTAGCGATGCTTCGCTTGGCGGTTGGGCTGT
GGTCGTTAGCCAAGTCCGCGACTGGGTGGATGGTGTGCCAGTGACTGAGCAGGCCCATGAGCTATTAGTTTGCAAAGGTGGACTATTTACCGGGGCACAG
GTGAATTGGTCCATCGTAGAGAAGGAGGCCTATCCAGTGGTTCGTGCCTGTGGTGATCTCGCCTACCTCCTGGAACGTGAGAAGGGTGTGCAGATCTACT
GCGATCACGCAAATCTGATCCACATCTTTTCGCCCGACAAGACTGTCAAGCCGCACTTGCGAGGAAAGCTCCAGCGCTGGGCACTGCACATCGTTGGAGT
TCGCTACACTATCGAGCATATCAAGGGCGATGATAACGTCTGGGCCGACTTAGTATCACGGTGGGGCCAAGTGGGTGCTGTGCCGGAGCACCCACCCCAG
GCCGTCAAGCGGCTGGTAGCCTGCATGCGCCGGGGCCATCGTGAAGAGCGTGATACCGCCAGTGAGGGCGGAGACACTGGTGAACACCGCACCTGCGGCC
CGCAGGCCACTGAGCGGGATAATGTATCGGCGGCATACTGGCAAATCCCGCTCCAAGATAGCAATCTTGTGACGGCCAAAAGGGTGACGACACGGAGCAC
GCAGCCGGTTTCGGTGCTACGGCCGCTGCAGGACAGCAACTTTGTGTGGCCCTCGGAGGATGCAGTCCGAGACCAGCAGCAACGGTATCGTGCCAGTGCG
CCGGCAGTTGCCGACGAAGGACAGCTTATTCGTGTTGATGAAAAACTATGGATTCCCAAACAAGCCCGCGAGTTGTTGCAGCGCCTGTTGGTGGTCGCCC
ACTGCGGCCCGCAAGGCCACCGAGGCAGCGATGTGATGTACACCGCGCTGACTGAGCGCTTTGTAATTGCGAATGCCAGGCCGGCAATTGATCGATTCCT
ACGCGAATGCTTACTGTGTAAGCATGTGAAGGGTGGTAGGATTCTGGTGCGTCCATGGGGGCCTACATCTACTGCGATGAAGCGCAATGAGTGCCTCCAC
ATGGACTACCTCCAACTGGGAGAGTCCTACGGCACGAGCCGCTACGTACTTGTCCTCAAGGATGAGCTTACACACTACTGCGAGTTGGTAGCTGCTGATG
CAGCGAACAGCTCCACGGCAGTCGAAGCCGTGCTGGATTGGTACAAGCGATTCGGGTTGCCAGAAGCCAGGGTATCCGACAATGGATCCCACTTCAAGGC
GACGGTGATGCAAGAGCTTGCTAGTCGCTTGAAGGCCACGCAGAAGTTTGTACCGGTTTACACGCCGTGGATCAACGGCACTGCTGAGCGTGTAAACCGG
GACATTCTTCAGGTGCTACGTGTAATGATTATGGAGCTACATCTAAACACACGCAATTGGGTCTATCTCCTGCCGGTAATTCAAGCCAACTTGAACCACT
CGGCGGTGGCATCTATGGGAGGACATGCTCCCGTCGAGCTGTTCACGGGCCTACCGGCCTCGTCCCTACTGGACACTGTGGCGATTCCCACAAATGACTC
CTACAGGATGCTACAAGTGGATCTGACTCGGGTTGCCCCACAACTTGACAAGATGCGGGGCCACCTTCACGAGCTCCATGGCGATGTCGTCGATCGCAAG
GAGCGTCGTCGCCTGCGCGAGATCGCGCGAGAGAAGGGCCAAGAATGCAACTTCGCCGAGGGCGATTTCGTGCTATGGTCTCGTGTAGACACCCGCATGC
GCGGTGGGAAACTGCTAGTGCGTTGGGTGGGTCCATTCCGCGTGGTCCGTGCACTCTCGCATTCGTTCATGGTAGCCCATTTACTTACGGGCGACGAGTA
CGAGGTGCACGGCTCACGCCTAAAGCATTACTACGACTCCGAACTCTGCAGCACCGCCGAGATCCGTGAGCATGTTGCCACGCAGGGCATTGTGCTGGGC
GTGCGTGCCATTGTTGACCACCGTTACGACTCCACTGCAAAGGAGTGGCAGCTGTACGTGGCTTGGCGCGGCCTCGAGGACTCGGAAAATTCGTGGGAGC
CTTTTGCAGCTATGTCCGCTGATGTCCCGGCC