Description :
From Genome Similarity Track
Location :
scaffold_105:10049- 11772
Transcript NameFunction/comments
Pl_109649hypothetical protein PHYSODRAFT_478939

Sequence
1723 bases(100 bases per row)
ACAGCACCAAGCTATGGGACGCTCGACCTTCCAAGTACGCGCAGAACATCATTAAGAATGTCTGTGTGTTCATCTTCGTGATGACAATCTGCGAGGAGGT
GGCCAGCTATGCCGTCAACCAATCGCTCAAGAACTTCTTCCAGCGGCTTGGCTGGTCCAACAAGGGTTCCAATTCCATGAAACTGACATACGACTCGTTG
AGTCAGTTTGCCTGCATTCCTGCGGGCTACATCTCGGATGAATTCCTTGGCAAATTCAAAACATTGCTTACTGCTGCATCGTCCAGTTCTGTAGGCTTCG
TGCTGATCGCACTGGCAGCTCTGCCGTCAATTCGCGCTACTCAATCAGTGAGTAAAGCTCTCTTCTGCATCGGCCTCTTCGGTGGCGTTGCACTCAACCA
GGTGTGCCTTCGAGCGCTGACGGTCTCATTTGGCGGTGATCAATTCTCGACCAACTCTCCTCCAGATGAACGCGCAAACTTTTTCAGCCTCAATTTTTGG
GCATCCCGAATCGGAATTTCCTTTAGTTACGCTGTATTCCCTTCACTCGCTATTCACGGCTTCGGTGCCATCCCTGCCGATTATGGTTTCGTGGCTGTCT
ATCTGGTCGGTCTGCTGATGCTTCTCATATTTGTCGGAGTGATGCTGTCCACACGGAAGCGCTACGTGGACATACCACCCACAAGAAGTGCCCTCGGCAG
TGTGATTCGTGTTGTTGTTCGTCGCGCCAAGCATAACTTCCAGGCGAGGATGATCGTACTAGGTACTATCATGTACCTGTCTGCATTTCTCCTCAATTTC
CCTGCGGCATTTTTGGCAGATCACGGCGAAGTGGGGCACAGCATTTCGTACGCATGTGGTGCGCTGACCGTCGTTGCCACCATCATCTATATCTATTACG
CTCGGGACTCCTCCTTCATCGATGGCGCCACCGATGCGCTCGGTGTTGAGCTTGACCCTGAAACAATTCGTGGTATCAAGCAAGTTATTCGGGTTTTACC
ATTCAATGCCTTCAACATGTTCTGGTGGGTCTGTCAGAACCAGCGCGGCAACAACCAAACTATAATACAGCAAACGGATGTGCGCCTTGGGAGTACACCC
GATGCCAGCCAAATACCAGGACCAACGGTTCAGATATTCAATCCAGCATCTGGATTATTATTTGTGCCGCTTCTCGACAAGATCGTCTACCCACTGTACG
AGAAGTACGCCGGAAAACCACCGAGTCGGTATGGCAAGGTGCTGGCTGGTTACGTCGTGGCTATCATCGCCATGCTTTGGACGGGTTGCTTTGAGATTAT
TCGCCGCAACTCCCCACTACTGACGTACGAAGATGCCAATGGAGAAACCCAGTACATCTTAAACGATGATGGTGGCCAACCCATGAACGATATCCCGTGG
TATGCTGGAATTCCTCAGTACTGTTTGGTGTCGTTAGCGACGGTGTTTATCCAGATTTCGACGTACAACATCGGCTACACGGAGGTCCCATTGAGCTTGT
GTGGCATGTCGATTGCTCTGGGTTTCTTTATGAACTCCATGGGCAGCACGCTGATGTCTGTGTTCGTCCTTCTCTTTGGCAAGTATATTCCCACTGATTT
GAATGACGGTCATATGGAGTATATGTATTTTGCGTTGGCTGTTGTGATGGCGATCAACACATTCTTTTACGTTTTGGTCATGAAGGAGATGAACTTCGCG
ATGATCCCACCGGTTGACAAGGA