Description :
From Genome Similarity Track
Location :
Scaffold_4:100465- 105494
Transcript NameFunction/comments
Hyaar_Emoy2800760putative polyprotein

Sequence
5029 bases(100 bases per row)
GGAGTCGAGGAAGACTCCCTGTTGAGGTGGTTCCTCGAAGTGGACGATGCCGTTAAGGCTCGCCACATCGACAATGAGGAAATGCAAGTTGCATTTGCCA
AATCGAATTTGTCAGGCGTGCCAGAACTTGGGCCCTGAATCTTCGATTACACGATCCAAAAGTGTTTGAATCGTTGGCGGTCTTTTAGAATCTGCTCAGC
CAAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTAACAGAGCCCCTGAAGATAAAACAAGGTAAGCATGACGTTCACGCTTACGCTCCGCAAGTTC
GTTACCTTACAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATTACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAGCCACCT
ATTTCGCATCGAGTTAAAGTCGCTTGAGGAAGCGATTACAACTGCAGTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCCCTATCGT
CCTTCGAGACGAGTAGAAGCGGGAGGTCCAGAACCAATGGACCCCTGCAGTGTTGAGAGCAAGAGACCTCGTTCTTCAAGCAGTAAGCAATTGAAAAAGT
GCAATCGCTATCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAATGTCTCGAAACACTAAGCGAAGTGGTCGACCGTCTGCCAAGAA
GAGCAACGGAAGCGGGTCCGACGCTGTTGCGAAGTCACAAAAGCGATGCGGACCATCAAAAAACGGTCGGGGTCAGTTGGGGCGGAGCGCCCTACTGATC
CAGAAACCTCAATAGAATTTGCAAATCCATTGATAAAAGTTGCTTCAGACTCACAATCTTTCTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCAC
CTTGACTTTAGAAGTTACAGAAGATTTGTCGCTTCGTGCCTTAGTAGACTGTGGGGTGTCGAACAACTTTGTTTGTCGCCAGTCGCTAGAAAATCGTAGG
CTCAAGCTCGTTGAGCGCGTTACTCTTACTACGAGGCTGACGGTGCGCCTAGCAACAGACGCATCGATAACATTGATCAAACGTGTAGTGGGATTTCACT
ACACGTTAGAAGATTTGCAGTACAATGATGATTTCATCGTACGTGATTTGAATGACAAATTTGATGTCATCCTGGGATTACCCTGGCTCAGAAGATACGA
GCCAAGAGTGATCTGGCAGCATCAAACAGTGAAGATGCATGCCACTTGTTCATCAGATGGCCATTTGATGAACGTCTTGGAGCGTTCACAAGCGTATGTA
TGTACTGCGAGTGATTGCGATGGCCTCACTTGCGGTACGGTCATTAGTAAGACTGCACAAGGTCACAGTGTGACAACCAATCACACTGTGGAGGAATCTT
CCGGCGGTTGTGCGGATGCACAGGCAGCGCCAAAGGTCCACTACTCGAATAAGTCGAGTGGATCGGGACATGGGTGTACGCCTAGTGGGCGACATCCTAG
TAATAAAAAACCGGTTGCTAACACAAGGCAACACGATGATCCTAGATCGGCTGGAGAGTCGATCGTAGAGGACATAGCTGTGGTAGCGCAACCACAGCTA
GAAGACGTCGAGGGAATAAGTCCCCACGTACTTGAGGAAAAGGGTTATCAGGAAGAAACCGAGACATTGAATGTCTTGGTTAAGGACGGGTCAGATGTAG
GCGCTTATACACTTGATATGATCGCACCTCTGAAGTCGTCTTCGGAGATCACTCAATTGCCAACGCTAGAACTGAAACGGTTCTTGCGAGATCTGCGCAG
TGACAAGGTCGAGTGGATATGTGTACTCGTCACGGAGGAAAATACGTGACTAACATTCGGTCCGCAGTAGTATTTGCAGAGAACGAACGGGTTCTCAGCA
GCTCATCGATGGACGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCGCTCCAGGCAAATCCTGTATATAAGGA
TTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTGAGGATAAAGGCACGCGACATGAAATCGAGCTCAAACCGGGCTCGAAG
TACTGTTTCATGAAGCAGTGGCCACTACCTCGTGAACAAGTACTTGCGATCGACAAGTCCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAA
CTCCCCCTCACATCTCTCCGACCTTCTGTGTGCACAAGGCCACAGGAGGATGGCGGATACTGCACGCATTCAACGAGTTGAATGCTGCAACGGTACCGGC
CCAGATGCCGATACCGAGGAAAGACGTAACTATTGATGTTAAGTCAAAGAGTACCATCTTTTCGTCCATGTATCTGATGGATGGCTTCTGTCAGATCCTA
ATGCGTGAACGGGACATCCCGTACACGCCCCGAGCGGTGTGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGATACGTTCAACAG
ATGTGTTACAGATCTGTTGATATCGGTGCGAGACTTCGCACCGAGCTATTTCGACGAAGTATTCGGCCGTAGACGGGCGATGGGAGGAAAGACGGAAGTA
GAGATTCATAGAACTCACGTTCTTCAGGTTCTTACACTTATGCGCAATCATAAGCTGTACGCCAACCTCAAGAAGGCATATTCGCTGCTAGCGAAATACC
ACTTCTTGGGTGCATCGTGGGTAAACACGGCGCACGCCCTGATCATGAAAAGATCAAGGCGATTATCGAATGGCCTGTGCCAGTCGACGTGAAGGACTAA
GAAAGTTCCTTGGTCTAGCAGCGTACTTACACAAGTACTCGCGCAACTACGCTGAGATGACCGTTCATCTCTCTCGTCTCTTGATAAAGAACGAGAAATG
GTCATGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATCGAGCAGAGCTTGATGCAATCGCCCATCCTGGCGATTGCAGACCAAGACAGACCATTCCAT
GTGGCCTGTGACGCTAGCGATTTCGCAATCGGGTGCGCATTAATGCTGTACGATGCAAACGGCGCAGAGCGCGTCGTCTGTTATCAATCGCGTCAGCTGC
GAGCAGCTGAGCACAATTACCGAGTGCATGATAGGGAACGCCTTGCCATGAAGTATGCACTAGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGACCGTT
CGTAGTCTATACGGACTATGCATCATTACGCGTGGCCGTAAACAGTCCACACCTCTCCCGAAGGATGGCGAGGTGGATATCCTTCTTCGGAGTACAACTT
CTCCGTGGAGTACAAACCCGGACGACTTAATGTCGTCGCGGACGCGTTTTCGCGCCGACCCGATTTCGAGTCGGCTGTGCAGTCCAACAGTGACGTTGAT
ACCACTGTTGCAACACCAGTCACGAGTGTTCCATCGTCAACACTGTTTGACAGTATAAAGAAGGCCTACGCAGAAGATAAGGCCCTTCTGCGACTGATGG
ATTATCTGGTGAATCCATCTTGTAAATCTCTCAGAGATTTACCGGCCTTGTATCGATATTCCGCGGATCGATACACAACACACAACGGGTTGCTGTATTA
CACAGTCGAAGCCGGCGACACTCCTCGTGTCGTCATACCCACTCATAACGATTTGCCATTGAGCATCCTTTATGAGTGTCACGACGCACCAATAGGTGGG
CATCGTGGGTGTGAGAAGACTTATATCACGGTAAGTCGCGACTTTACTGGCCCCTCCAGTATCAGTTCGTGGGCAAGTACATTCGGGCTTGCAAAGTGTG
CCAACGGGTGAAACCTAGTCCTACATCCCTTGCACCACTACAGCCTCTCCCAATCCAGGCAGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTCTTCGGT
TTCCCCAAAAACGCTCACAAGAATAACGGTATTCTTGTGTTCGTAGACCGTTTCAGCAAGATGGTACATCTTGCTGCAGTTAATGATTCAATTTCAGCAC
ATGACAGTGCCCGTGGTTTTTTATTGACACGGTATTCTAACTGCACGGTCTACCCCATGAACTAGTCTCTGATAGAGATCCTCGGTTCACGGTGGCGTTT
TAGCAATCCGTGTTTCGATCCCTCCGAACACGTCTGACGATATCTACTTCTGACCGTCCCGAGACTTATGGTCAAACAGAACGCTTCAAAAGAGATACTT
CGAGGATACGTTCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGGAGTTATCAAACCAACAACTCCGTGCATGCATCTACAACAAACACCATT
CTTCGTGAATGGCTTACACCATCCACGCGGTGGGGACCCACCCATTTAGAGTGTGACACTAATTCAAGGGGGGGGATTCGCTCGAGCAAAAACCGTTCTG
TCTCTTGCTCATCACGCGTCGAGGTATTCGACGACGCGAACGTTGCCGATGTCTATCAAGTCGACATCGAAGAAGATAACCTTATCATAGTGACGACACT
ATTGCTGATCCAGATGAGGATGACGATGCTGGTATATTCAGCATCGTCAATGACTACACCAGCGAGGATGAGAACACCCTCGCTGAAGAAGAGGATAACC
TCCTAGAGGTGCGCACAAGGCGCACTGCAACAGACCAAAGTGATGCAGCAGAAGATTTCCTGCTATCAAGAGAAGCAGTGGTCCGCTTCGTACAAGACTC
CATCGCTAAAGCGATGGACCAGCAGAAACGGAACGCTGACAAACACGGAAGAGCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTCTAATGTCTACG
GTAAATCTACCTAAGCACCCAGTAACTAATGCGGATAGTAGTAACCTACGACCCGAGAACATCGGCCCGTTCCGTGTACTACGTCGCAAAGGCAATGCGT
ACACAATCGAGTTGCATCGCAGGATGCGTACACATCCTACGTTTTATGTAGGTCGTATCCGCCCGTACCATCCCCACGAGGTCTCTTCCTCGGGCAAATA
CAACCGCCACGCTCAAGAACCTCCAAGCG