Description :
From Genome Similarity Track
Location :
Scaffold_1069:1004- 7857
Sequence
6853 bases(100 bases per row)
TCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCGGTTACGGTTCGTACGATCCCTC
AAGAAGTCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATTCACGCCAATACACCAGAAATTCACGGTAAACCC
GTCCGTATCTAGTTCGTTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAG
GACTTCGTCAAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACT
ACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCGTGTTCTCCAATCTTCTTGCTCACCCGGAACGGTCCATGCCATAGATGGGCCA
ATTTGCGGGCGTACCCTTCTTTCACCCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGC
TCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTT
CTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTT
GGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTAATGGCTCTCGTGATCGTCTG
TACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGAC
ATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATTTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTCTGCGCAGTTCTAG
ACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAGTTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATC
CATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTTC
CCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGACCGTTGGTAGGTCTGACCAATACCCTGATGTCCGCCTTCCAAGCT
AGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGCA
ATAGAAGAGCAAGTCATTCAGATCCACCGTGTAATCCGATAGCGATAATGCCGTAGGTTTGGCATCTTTCCCGACTCAGGTCTCAAACATTCCCCTAATC
AGAAATTTCATTTGGTCCGAGGAACACGAGCTTCACTCGTTCAGGTCTTTAAGGAATCACGCTTGCATTGGGAAGTGTTTTGTACAAGAAAGTTCCGAGC
AAAGATGTGGGAGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATTCGCCTCCAGTCCCTCCTCGGAGACTCGATGACCTAAGTAATCCACCTTGC
GCATCCCTCAATAGCTCTTCACCACGCCGATAGAGTGATTCCACTTAGTACACGCCTTCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTC
CGCCGGTATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGATGGGATCCCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTG
TGATCTTCCCCGGATCCACCCCTGTCGGGTTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCA
ATCCAAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACT
GGCCATGTCTAGAGAACGGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTA
ACCAGCCGGTAATCAATGCACATACGTATATCCACCCCGTTCTTTTTGATGATGATTACCACCGGAGATGCCCACGGGGATATTGAGAAACTGATGATCT
TGGCTTGAGCAGGCCTTAATCAGATCTGATAGTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGGTTCGCGGAGTCGACTCGATG
TCACATTTGACTCCGCGGTTGCGGAGGTCAACCATGTACATTTACAAATCAGAGAAAGTCGGGACTTACAGATTGTTCGAGCAGACTGACTACTTGAGTA
GCTTCACTCACCCCCATATCCTTTTGAACATCATAAATCGAAACTTCTTCTGCGATCGAGGGCAATGCAGACATCGCCGATAAGACATCGCAGAGAGCCC
CTTCACATAGGCAACAGAGTAGCTCATCTTCCGTCTTCGTAGGATCCACCTTTGGATCCAAACACCGCGGCCCTCTTTCGCCGGGCAGTCCTTCTGTCTT
CGGGGAATCAGGTACCCTGGTATTAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCC
ACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCTCTCCTT
CATCCACCGACCCTGCGTTATCTAAGAGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGTTTGGATCTCAACCCGTCGATCCCTCTG
CAGGATCTTTCGCGGAGTTGGATATGGAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTC
GCCTCGTGCACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCACCCGA
TCTCCTCATAATGGTCCAGTATTAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTACGATCGACCTGGTCCCTGAATTACGGTAGGCACCCATTT
CTCGCCCCGAGTGATCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAATAACCAGGTTTCTCTGGGCTCGATCCAGGTCGTCTTATCCGCC
CTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCACCC
TCACTCCGGCTGGCACCATGAAATCCATCTCGAGGATGACGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTATACCAAACAACCTGCCAG
CGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTA
CGAGCAAAGGTGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGAAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGA
ACCACTTTCCTGGAGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTG
ACCGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGT
AGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGACAACTGACACTTCATGTAGATCACGTGTATTAT
CGACTGGATATAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACC
CGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTT
CCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTTTTCACAGA
CCAGATGTTTCCAGCATCCCATATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACA
TCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTC
AGGGTCGAAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTT
TGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGACCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTC
GTAACAGGGTTAGCCTGTCGGCCAGATCCACGTCTTTCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTT
TAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGACCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGAC
ACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCC
CCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACATGACTTTGCTGATCCATGTCCTCGCTCGGTC
CTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCC