Description :
From Genome Similarity Track
Location :
Scaffold_524:1004- 2660
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_524-abinit-gene-0.31ATP-binding cassette sub-family F member 2

Sequence
1656 bases(100 bases per row)
ATGGCGATGAATTTGATCTCGCGTCCCcTGTGGCCCTTCCAGATAGCCCTCAGCAGAACGAGCTGTGGACCCGGGAGCTCAAAATGGATTTtGATGAGCC
TtCCGATGCCGTTGTTGAGGACGAAACTCAAACGGGGATTTCACATCTAAAGCAGACCGCATCTCAAATGAGTTCACTGACATTTCCTCGCAACATCGCC
CGTGCATCTCGGTCTTCAGGTTCGCATGCGTGGACCCCAGGGAGAGCGAACCAACCGATAGAGCCTAAGCCCAAGATCCGACATGGGGGAATCTACTCGC
TATTACTGAAGAACCGCCCAGCAGAGAACGAGCCTATGCTAGTAGATGAGAGGAAGAGCCCAGGTCCAGAGGGTGAGTTACTCCATGAAGGCATATCTGT
GGTAGGAGAGGCATTAACTGTGTCACATGAACAGTGTCGCCAGGCCCGTCTTCTGTCAACAAGGTGACACTGCCAGTTGCATGTGATGCTTTGAGAGACG
CTAACAAAGAGTGTACTGATGCTATAGAAATCGTCTCCTCCATCATTCACACGCCTGCAGCATGGAGGCATCTACGGGGCGTTGCAGCGCAACTCGAAGA
ACTCGGGTTGCTGAAGTCCTCTCAATACACCTACTTCTGTGTGTCCATACCTTAATATGATACGTTAATGCCGTTTTTCGCCCCCTTGGTCAAAACATAG
CTAATCGAAACATTCTCGTAATTTACCCACCATCATTCTTCTCGCTTGGAACCCACTCGGCAGCCTAGTGTGACACAAGCGTCGAACAAGCAGGCGAGAA
GCGTCGAGAGCGACGACAATGAATCGGATATTCGGGCGCAAGAAGCCGGAACTGCCCAACGTGAACATCTCCGATGTGAACGCTAAGGTTgACGGGCGCG
TCACGGACCTGGATATGAAGATCAGCAAGCTCGACGAAGAGCTGCGCAAATACCGCGTGCAGGTGAGGAGGAAGGCCGTCATGGTTGGTGGTACGAAGCA
CTTGCTGTATGATTGACTAGAGAGCtGTTTTTTTtCATAGATGTCAAAGACCAAAGGCCCTGCGCTGAATGGTATCAAGCAGCGCGCAATGCAGACGCTA
AAGCGCAAGAAGATGTACGAAGCCCAGCGTGACAACCTCACGGCCCAGTCATTCAATCTGGAACAGGTATGTCAACAACCATCGCaTGGGAAAGTAGTAG
ACGCGTGTATGACGGAGATTGCACTGTTGATACCATCAGGCGAGCTTTGCCGTCGAGTCGTCACGCGATACGATCTCGACAGTCGCCGCAATGAAGAGCG
CAGCGACACAACTCAAAaTTGAAACCAAGAAAATTGACCTTAATGAGCTCGAGGTAGCTGTCTTGCCCATTtGTGTGTGGGcTCCCTGTGCGACGGATTG
ACGCGTATGGCGCTTGATATCAGGATATTCAAGATGATATGGCTGATCTGCTCGAGGACATGAATGAAATCCAGGAGATCATGGGACGGTCGTATGGGTG
CGCAACACATGCATGTAGCTATCACTGTGTTGTTCTGATGCACACTGTACAACACTTGTTTTGTAGCATTGGAGCTGACATTGACGAAAGTGAGCTGGAG
GCTGAGCTTGAAGGACTTGAGGAAGAATGGGCAGAAGAGGAGGCCGCAGCCACCAC