Description :
From Genome Similarity Track
Location :
Scaffold_146:10036- 12492
Transcript NameFunction/comments
Phyta_totarag4522hypothetical protein PHYSODRAFT_496573
Phyta_totarag4523hypothetical protein PHYSODRAFT_313263
Phyta_totarag4524hypothetical protein

Sequence
2456 bases(100 bases per row)
TGGTCTGGAGAAACGTGGATGTCTAACACCCGTGTtgattgctgctggttggtcAGGCACTCGTACTGATGCTGTCGCATCCAGCACATCGATTGAGTCA
AAATGCTGCTGAACAGCTTCTGCGGTCGTGGTTTCACCCAGCAAAGGGGTCGACTCTCTAGGGCAGCAAGATTAAATAGATGAGCAGGCCTGTTGTTGGT
CCATACGAATGGGGCccgtccgtcgtcgtcagcgagGCAGGTGGCAGGGCGAAGAGGTTGCTAGCATGGTGCGCCATAGCGGAAGCCGCCATTCCTCTCT
TACGGTATATCCGCAAAAAAATCCGAGATGCCTTCGCTATCGTCCAGATTGAAGCAGAAATCTGGATCGGTCTGCTCAAAGATATAAAGCGCAGCGCGAA
CCAGTGTTAATAGGAGGAACGACATGGTCGACCAGTCTCAAGTCTGTGATCTGAAGGCATAAGTAATTCAATACCTTTAGCGGCGCGAGTTTGAAGATCc
cgctgtccgagtcgtATGATCTCTGCTGTGGAAGGTGCAAAGAGACAAGCAGGGATATAAGCACTTTTCCTTAAGGCAGCGCCCATGAGGATTGAGCACC
AAAAACCAACTCACCTGGTCCAAAGGAGGTGCAGGGCTATCAGGCGCTGCAAACGCTCCGGCTTCCTTTGCCGCTTCGTTGACAGCCTCTGCCTCCTTTT
CGTCAGCCATTCGCCGAACTAAATACACATCCACGGGTCCATCTGGAAACGAGATATCAATAAGGAAGGTGCCCATATACCCTGGCGACGGACTCGATAA
GATGGATCGCAAATTGCAGCTTCTCATACCTGTAGACTTGAGGAAGACCTGAAATCGGCGTTTTCCAGCAGGCATACCCTCGTCAGGGTCAGGCACTTCA
AGTGTTGTTCCTGGAGGAGCCTTAACCGCCATGACGCTCTGGTCTGCGAAACTCTCTTGCCGTCGCATGTCGTCGTGTGTAACATAGCAGAAGTTATCAA
AACTGCCTTTGTCGaacgcttcttcttcatacAGACGTCGAATGTTCTGACTGACCATCTTGATATGCTGGTCATACTTGAGTTCCTCTTGCCTAAGATC
TGAAATGCTTTGTCGAAGGTGATCCATTCCTTGATAGCTGTCAGTGCCACCTGTAGGCCCACTAGCACCTCTGCATAACAACAAGCGTCGGCAAACGCAT
CGTCACCGTTAGACCGATGGCACTGCAGTTGCTATAGCTGAGCTCGTTAGGTTCCACTTCACGTACTTCCAGTGAATATTGTTCTTGGACGTCTTCTCAA
TGAGGCCGATGCCTTCCAGCACATTTGTGATGTCATATATTCGTCGTTTCTGTCGATATACAACAAATTAGTACGTAAAGCCACCATACGCCAGAACGAC
CACGCTGTTTCGACACAACTCTCCGAGCAGTTGCAAGCGCATCTTACCTGAACGCCAAGCGATTCCGCTGCCGTGTTCAGGTCCAAGTCCTTTGACGGAG
CAGATTGGATCAGCTCCACGAACCTCTTGGTCAGCAGCCCTAATGAACTGTCGTATCTGCTCGCTGGAGATGGCTTCGGCCCTGCAGCCAAGACAAAATG
CGTCAGAACCACTCGACCGCACACGGTACTCTGCTCCCTCTGTCTGCATATTCATAGGCAATAGCGTAATAGAACGAACCCCTTGCACTGGGACTCGGCG
ACTGCAACTTGGGCGGCGCCACGGCGGACGCGAGTGATCTGGACGCGACTGCCGCGGCGTGGCCAGTGGAGACTACGGGCGACGCCATCGCGGCCTCGTA
CCGTGCCTTGGGGCGCTtgatcttgcgcttgagctcctcgttcGAAACCTTTGCCTTAGCCATCCCGTCCAGCTAACTGGAAGatccgccgctgctgcta
cttATCTCGCCCGGTCTGCTGTCCCTTGGCAGAGCTTCCGGTGGCTGCGTTTCAGTATTCAGTACGTGGGTGACCCATCATACGGCATACAGCATACCTA
TTTGGTGTCGGTACAACCTGCAGTATGCTTGAGCGCAAGAATATGCTTTACGCCGGGGAAATGTATGGCCGAAGTGCCACATCACCATAGTCGATCGGAC
AGCAAGTAGCTCGCTAGCATGGGCATctcaagcagcaccgccgccgccgctccAGAGCGCAAGGACTTGGAAGATGAGATGGTGCTGAACGGTGCGTACt
ttttctgctgcagtggcggcCTGGTAGGATTGCGCGTGGTTGGCTGCGTATTGACGTGAGGAATACCGTGAACGCGGGCAGACCTCCATATCGAGACGGG
CGACCAGAATGCCGTCAAGaacctgctggacgacgctaTCGTGGAGTTCTttcaggagaaggaggatTTCAAGCTGCACTATGGATGGGAcaacgccaag
ctgctgctcatgctgctggcgacgaTCATTACGGCCGTGTCGCATTTCTACAAGCA