Description :
From Genome Similarity Track
Location :
Scaffold_396:10034- 11613
Sequence
1579 bases(100 bases per row)
TACTCTACGAACGTGATACGGCTGGCCACTTCTGGGTATGCGATCACGCGCTGCTTCCTCGCAAAATCAGCGACGTAAACCGCCACCTTGCTTCCCACGT
GGAGAATCTCGCCCCGCAGCCACGCTGAGCATCCATCGCCACCGTCCGCGAGGAATTTGGTGGTCGCCACAAGCACAATAGCATCCGAGTCGATCTCGTT
GCCGCTCTCGTCCTTCATTTCGCTCACCACTGGCGGTAAAATGGTCGCGTCGATGGTCAGTCGAAGGCCAGACACGTGTGGAAATGACCCAGAGCGCTGC
GGGTACTTGGCCAAGTGCTGCGTGATGGCGCTCCGCAAATCGCTCGCGCAAATGCGGACTAGAACTCCTGGTCGCGGGAACGGCATCTCCTTGTTCAGGA
TCCCAGTCGTGAGGCTCGAACCGGCGTGATAGAACTTGTCTCCCCTGATGAACCCGCCGTTGACGAGCGCAAAATCGGCTTTCAGTCCTGACCGCAGAGC
GTCGGCCACCAAACTCCCCATGTTACACTCTCGCGACCTCAGCGCTTCCGTCTTGGTGGACAATGGCCGAGTCAACACCGCCAGTATTTCGGCGTTCTCG
GCACAAGCGTCTTCTTCCTCGATCGCACGTGCATACTTTTGGACAATCTCACTGTAGACGGCATCCGGGGCGATGTGCTGGTTAGCGATCATGCTCCACT
GCGTCGACACGTTCAACGGCTGCGAGTCCAACTTGGTCAACTCGAACTCGAGCCTGGCGAGCCACATGGCGTTCTGACCAGACTTGTGGATCAAAGTGTT
GCCCTCGTACAGAGTGTACGGCTCGTGGTCGTGTCCGCCCAGCATCACGTTGATCCCCTTGACGCGTCGTGCGAGCTGGCGATCCTCATCGATCAGCAGG
TGAGTGAGCGCCACAATGAAGTCGGCACCTTGAGCTTTCAACAGATCGACACAACGCTTGGCATGTTTGAAGACATCGTCAAACACGACATCGTCGCCAG
GGTACGACGTCAGTGGTGTGTCCTCGGTCGTCACACCGAACAAACCCAGCTTCAGACCGTCGCTCAGCTCAATCATATCGGTATCGATCACACCCTCGAA
CAGCTCGCCAGACTTGCTCTCGAGCACGTTCGAGCCGAAATACTTGAACTTGGACGCCTTGATGCGCTCTCGCAGTACTTGGCAGCCGAAATCGAACTCG
TGGTTTCCCAGCACGACGTATTGTATGTCTAGCTGGTTCATCAGCTCGATCATGTGCTCTCTACAACAGCGCCTCGTCAGCTTAGCATCTGAGTTTGGTG
GAAATGACCCCATACATACCCTTTGCACCGCTCTCCGAGCTCGGAGCCAGACAGAAAGTCGCCATTGAGAGTGACGAGCAGCGTCGCGTCCGTCGGGACG
GCTGCTCGCTCGCGAGCCAGCAGTGTCGCGAAGCTGGCGATGCCTGCACATTGTTAGCACGACTGTCAACCACCGCGCATTCACTCGAAGGTCCTTGCGA
TCACGAACCGCCGCGACCGCGCTCGTCTGCATACACATCGTGCACGTCGTTGACGGAGAGTACGACGAGCTTGGCGGCG