Description :
From Genome Similarity Track
Location :
Scaffold_2:100326- 101347
Transcript NameFunction/comments
Phypl_g79conserved hypothetical protein

Sequence
1021 bases(100 bases per row)
GCGTGCCGAGGCCgttgccggcgccgccgtcccAGTCCTCGAACACGGCGATgaccttggcgtccttgggCGAGATGGAGCCGCGCGTGGCCATGAGGCG
GTCCTGCCAGTACTGCGCCTGGTgcggcgtggacgtgcaCACGATGATGACGTCGTAGCCGTCCAGGCAGTTGATCTCATCGATGGTGCGCTGATGGGCC
GTGCGCGGAGCCATGTTGGCGGGCGTGGAGGAGGTCGGGAGCGACTTGGTCTGCTTGGTCGGCTGGGGGCGGAAGCGCAAGTGAGCtgcgaaggcggcgg
ccgcagcggcagAGGCGGCCAGCGAAATCGCCAGCGGACTGAAGAACTTGACCATTGCGATGCGCGTGTGTTGCAGCGGGTTTTTTTACGGCGTTATCTC
CTGGGAAGGGAGAGGAGTGTCGTTGTCCGTTGCGCGTGTGCGGTACGGGTCGAGGTGTCTGTCTCCTATCTATTGATAGGCGTCGTGCGGTGCGAGGCGC
TTAACCGGGAGGGAAATGGGAAGTGAGCAGCGAAACCCGCAACCGCCGGCGAGGATACTGAGAGAACCCGACACGTATGTGTGCACACGAAGCACAATGC
CACGACGACGGGTGGCCCGGTTATGCCTGCGCTAGACAGTTCGCCTCTAGAATCGCATGGATCTCGAGAAACGGATCGACGCGCGAGATTCTGAGCCATG
CATCCGCCGTTTGGCCGACCTGTCCACAGTCTATCCCCGCTCAATGAGATTGACTTGGGATCTATATGGCATACAACGGCCCTGTTCGACGACCGCGCCG
TTCAATCAAGTCGGCGCGGGCTTCAACACCCGTTGGACACGCGTGCCGAGCCGAATGAGACCGCGAGGACGGTGTGAGCtgtcgccgtcctcggccgcTT
GGATCGCAGCTCGTTGAGCCGGGCTGCTGacggccagctgcagcggcaccagAAGCGAGCACTTCTGGTCGATCGTGGTGTGGTCGGCGCGGAATCTGAC
CTGCATCCAGAATTTGGATTC