Description :
From Genome Similarity Track
Location :
Scaffold_160:10031- 11849
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_160-abinit-gene-0.47SET domain containing 3 isoform a (predicted)

Sequence
1818 bases(100 bases per row)
CAATGGAGTATGAAGACGATTTCAATGCATCTTCTCCTTTGGCCAGCAAGCATCGTGGTGCAGATGGCATGGAGGAGGTCGAGGATGTATATGACGAACA
CAGCGAAGAGAGAGATGCCACGAGCTCACAGGCGCCAGAAGACGAAGAAGACATACCGGAATTGAGTGGCGCAGCGAGGTCTGATGATGGTGAAGTTGCT
GAGAATGATGACGAGTTTGCTCAAAGCTTTCAAAGCGACGGTGGAAGCAATGAAGCGCAGAGCGCCAGCGACGATGCTGGTGTTCACGATGTGATCGCCT
CCGAACCCTCTGCAACTCGCGCAGTGGAAGTCCCAGTCGCAGTTCCTAAGCGCTCGAAAGTGCCAAACTCTGCACTGCCCTCGCACAGCGCCGTGACTTC
TAGGAATATCAATTTCGCCGCTTCTATTCTATCTCAAGAGATACTTGGCTCGCCAGCTTTCGGCAGCGATGTGGACGCGCAGTCGGACCAAGTCATTCAG
TCGTATATGGTCGAGTTGGAGCGGCGAAAAACGTCTGAGGAGTCGATGCTGAACATTCGCTTCCAAGCCGCCGAGGCTCAATTCGCTCAACAAATGCGCA
AAATTGAGTCGGCTCTCGCTGCGGCGGATAGTGCAGGTGCATCAGAGTTGACAGCACACAAGCAGCGGCTTGCGATTGCGTTTATGGGTGAAAAGGCCAA
CATTGAGTCTCTCAAGGCGGCAGCTACTGCGCGCTACTACCAGGATATGCTTGTGTTCCAGTCGCTTGTGGACGGAGGATGGTCGAAGGCAGCTCTTGGC
GGCCAACCCGAGAGCCAAAGCATTGGCATGCGCGCTTTTGCTACGGTGAATGCAGCCTCGCTGCAAGCCCCGCCATCCATGTCGATCGATCAAGGGAATG
AGCGCTCTGACGATGACTTCGCGTCGGTGCCGGAAAGTGACGCTCATGCTGTTCAACGCGCCAGCTCGACGGTCGAACAACGATCAGACGCGTACAGCGA
AGCCGAATTTGAGAATGAAACGCAGGAGGGTAGTGCACGTGACCAACAAAAGTCTGAGGGTTCCATCATGTCCGACCTGGAGGACGCATCACAAGCGGCA
AGTATTCAGGAAGAAGAGACTCCGTCGGTGGAGTCGGATTTCGAGCACGTCGAAGGAGACGAGCACGAGATGAGCGTGCACGAGGAGCCCAAGTCTGATG
CCTACGGCGAGTCCGACTTTGAGGACGACACACGAGAGAACAGCGACAGGGTAGAGGAGCATCCTGATGCGTACCCTGATTCTGATTTTGAAGACGAAAC
AACAGGAGAGGGAGTCAAGGAGGACAGCGCTGGAGGCATTGAAATTGACGAGGAGAGTGATCAGCAACAAGAAGTCGAAGAAGATGGTGGCGTTCCCTCT
CATGCTAGTGGCGAGGATGTCGCTGATGAGTTAGACGCAGATATGGTGCAAGACAGCGCAATAGAAGAGGACGGACGCGAGCTGCCTGACAGTAACAAGG
ATCTAGTCGACAGTGGCGACATCAAATCAGCGGAGAGCGACGCAGCTGCCGACTACTACGACGACTTTGCGTCTGCTGACGAGAGCACTTCAAACCCAAA
AGTCAAGTCTGAACATGAAGAAGTCGAAGACTTTGAGGCCAAGTCAGACAGTATCGCTGAGTCATCGGCTCAGTCGATCTCGTCGAACGAACCCGACGCC
GTCGAATCTGCTGCTGATGCGATGGTTTCCTCTGCTGCAAGTGTTCACGAACCTGCGAGTGATGGCTACTCTGAGGATGAATTCGAGAGCTCTGGGCATC
AGAAACACAGCGTGCTTG