Description :
From Genome Similarity Track
Location :
contig_36:100307- 101684
Transcript NameFunction/comments
g8753.t1hypothetical protein

Sequence
1377 bases(100 bases per row)
AATTCGGTCTCGTCACCTGGAAATAGGAAATATTCAATCCAGCGTAGACCCAGATACTTACGGAAACCTGTCAGTCGAGTCGCGCTTGGTAATTGCATTC
GTGAAGCTCCAGCACCACTCGTGTTACTTGATGCAGCAGCCATTTTGACTGCATTGCTAACACCCAACTCTATTACTGAGCTGTCCGGATCATCTTGGTA
ATCTTTGCTTTCCTTTATATCCAGTTTTTGCACCGCCTTCAAGAGTGTTTCCAATAGAAGCTCCTGGATCTTGGCTTGATGCGAGATTAAATGTGCATTT
ACCCACTTTGTAGGGCCAGGCTTCAATTCTGATACCTTTTGCCCTTGCTGTACGTTCCAACAATTACGATCTATTCTTTGAGAGCCCCTGGGACTTAGGC
ACAGTCTAGCTGTAGGACTCGCAAGGGTATGCGCTTTAAAACGAGCACCATCTTCATCGCTTGCGTTGCGCCTTTCATCGTCTTCTTCCACAATGATTTC
TTCTTCGGCAGCTTCTCCCCTGTAGTGGCCAAAGCGTGGAGACAACGTGGCTGCAAGGAAGCTCGTTACGTCTGCAAAATTTGATTCCACAGTTGACTCA
CGATTGGGGCTCGTCAAGCAAACCAATATTACGTCTACAATAACTCGTAGAAGATCGACCGTGACGGTTGCATCCATTAGAACGTAAAGTAACTGCCGGA
TGAAGCTCATTGATTGCAGCTGTGCTCGATTTCGTTCACGAATCGCCTCGTCGTCAGCAGCCAAGCACGAGTAAAGTGTTGAAAAGAGTACCTTTGCAGT
ATCCACACCAGGCGCCTTCTGCCAGAGTGAGTAGTCCAGAACAAAGTACTGCAACGCTTGCACATTACGGATCGCACTGTCCGGGGAAATTTGAGCTATC
GTTTCCAATTGCCGTTCTGGCTTCTCTAGCTCGATTTCCACACCAACAATACGAAAAATAATCTGTAGGCATGTGGTGTTTAAAACGATGCCTTCTTGTG
TAGAAGATAGTTCACAACGCCATAGCCATGATCATACTCCATCGCTGCCAGATTGCGCGAGTCACCTTGCATGAAAAGCCAGAGTAGACTGAGAGCCAAC
TCCACTTCCTCGTCTGTCGAAGCTTCGTCTAGCAGCCCGTACGCAATTTGACACCCAGAGCTACTGATGTCGAACATGGCAGATGCCATTGTCGCGGCCT
CACACAGCACAGTCCCTCCCATGAGATGCCCACTTGGACGACCATCAAGCCTACTGTTGGGAATAATCAGCAACTCGTTCGCTACTCCATTTCTGGCTGA
GTATGCCACGACAATCCTTTCAGACGGGACGGGAAGATGGATCAATGGCACAGCGCTAGGAATGCGAGAAAAGACGT