Description :
From Genome Similarity Track
Location :
Scaffold_160:1003- 2678
Transcript NameFunction/comments
g13116.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
1675 bases(100 bases per row)
ATTTGCTTCAAGCCGGGAGACAACATCGACTTTCGTGGCTACTCGGATGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGT
TCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGTAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTAT
CCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAAATCCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGC
ATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGC
TCGAGTATTGCGAGACTTCTGTGATGCTGGTGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGG
GACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAAC
CCACGCCGATTACGCCACCGACGATTACGCCACCGACGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTC
ATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCAAAAGACCTCAATCAAT
CACTTTCGAATCTTCGTTCTACCCCCCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCGGTGTC
CAAGATCCATACCTTCCATCACGGGGGTCGGCTGCGTCGGCTTCGTGGTCGACATAGAGAGGAAGAGACCGAGCAGCGAGCGTAGCGACGTGGCTTTGCT
GTGGCGAGGCTGGCGGAGCCGTATCGACAGTGTGGCGGGCTAGCGGCTAGCGGCTAGCGGCTAGCGGCGATGCTGCAGTCGGCTGTGTGGTGGGCATTGC
TGCGGTGGAGAGGCTGTGGGTGGGAGTGCAAGAAAAGAGCGCGTCCGGTTTGGAGGGTTTGGGTTGTTTTGGCCTGGTATCTTGCCCGAGTGGTCTAAGG
GGGCGGACTTAAGATCCGCTAGACATTCCAGTCTGCGTGGGTTCAAACCCCACAGATACCATTCCATATTGACCTCCTCCTCTTCGGAAGAGACGTTTGT
GCGTGCGTGCGCGCGTGCATGCGCATGGGTGCGTGCGTGTGCGTCGTGCTGCAGCCACCATGCTGTCGCTCCCTAGAGCGCGGAGCCTGGAGGCTCTTGT
TGCTGCGTTTGGGCGCCGGTAATTTATATCCCGCACGCAAGCTGGACGTTTAGGCATTGAGGTTATAACCTCAATGATATTGTATTGTTTTTCCTAATTT
GTTGGCTGGGCTGTGTCTAATGATGGGCTCGATCGACTTCTGGCGCGTTGGTTTGACTCTACGAGTCCTTGGTAAGATCCATACAAAGCACGTGTTGAAC
AAATACACCCGGACATCTTTTCACGAATGAGTAGTTACAAAACGTTTTAGTTGGCCTGCTTCCTGTTTCCTTACC