Description :
From Genome Similarity Track
Location :
Scaffold_26:1003- 2281
Transcript NameFunction/comments
Phyke_g1649hypothetical protein PHYSODRAFT_307684

Sequence
1278 bases(100 bases per row)
GGTCTCATCACATTGGGCGGCAATGATTCGCACAATGATAGTGtcgttggtgatgttgaCCACGGACCGCAGACGGTCGAGGATCCAGTCGGTGCTCACC
AAAACGGTGAATACTGCTGGCACGTCCACACCAAAAACTGTTCTCCACACAGTCAGTACCATGACTAAGCCCGCGTGGGGCACTCCTGCAACGCCAAAAG
ACGCAATGGCGCTAACAatggccagcagcacaaatCGCAACGGGGTAAGCAAGTACTCATACCCACCAGCTTTAGCCAAGAAGACACAAGCTAGTGGCAT
GTAGACCGCTGTGCCATTCAGGTTACTCGTGGCTCCAAGAGGCAACATAAACCGCGAGAGCTGGTACGATACTTCCTTCGTAGCGTCCACGCATCGCATG
GTCATGGGAAGCGTGGCAATCGACGACGAGCACCCAAATATGAATATTTGAGCGGGAATCATATGCCACAGGTGAGAGAAAATGTTTCTTCGTGTTGTCA
CGAAGAGAGTAAAGCCGAAAACGCCTACGGTAAGCGTCAGCAGAGCCGCAATCAAAGCCCCAATCAAGAAGGCAACGCCCTTGATCAGCTCCGTCGAAGA
GCTGTAACTAGCCATGGATCCAGCCACTAGTGAGGTGATAGCGAATGGGATGTACTTTATGACAATATTGACCATCAGGAGGATTACTGTGTTCGCGTGA
GCCACCATGAGCAAAGCATAGTTCTCCACCCCGGAATCCTTCTCCACGCTCTTCACTAAAGCAACTCCAAACCAGATAGCGAACGCAATGATACTTAGAG
TTGATGAGCCTGCGAAGGAAGCCGTGATGTTCTCGGGCACCAAGTCCTTCAGGATGCTGAAAATTTGCTCCGATACGTTCAAGTTTTCGAAATCCGTGTC
AGATGTCAACAGATAATTAGTCGCGCCAGCCAGTCCAAATAAACTGTTGGGCAGAGTGCCATTAATCGAAGCGCAAGACATTGTTCCGTTCGAGGAATAG
GAGAGGTACTTGCCACTGAAGCACTGGAAGCTCAGCGAAGTAGTAACGGGCTCGATTGTCACTGCAGTTTCAGACGGATACAGCttcgccatgaagaagc
caaaaaTGGTGCCAAGAGATGACGACGTGAGTGAGGCCATGGCGAAAGAGAAGATTATCCATCCGCCAATGGACACAGCCTTGCCAGCTTCCACCAGTTC
GCCAACGCACACAATAACGCTGCAGAAAACCATGGGCGTCACCAAACACTTGAGTGCTGAAATGAAGAGGGAGCCGGG