Description :
From Genome Similarity Track
Location :
Scaffold_3150:1003- 2051
Sequence
1048 bases(100 bases per row)
GTCGTTCTGAGGCTGTTGGTCGCCTAGGGAGTTGGCCTGTTCCGCGgttgataaaaaaaaagGGTTATCCCGTGTTTTTTTATTTTGTTTAACAGGGGGA
TCTTGCAAATGCACAAATGAGATGAACGAAGCAAGCAAACTGAGGTTCGAGTTTAAAAAAAATCTGGGATCCATTCGTTTCTAAGCTCGCCAACGGAATT
TAGAAACCAAAATATCTAACTTTATAGTTTAATGCAAtattttttatttttatCTCGTCAACACACCAGAGGGCTCCGGAGACATCTATCCAGTCCTTCA
ATATTTATAGGTAAGAACTATGCTTTGAAATAAGCTATGACGACATACAACTCCAGCAAACTATCGGAATAAATCGGGTAATTTATTCGTATAGGATACA
ACACGGAAGCATAACAACTGTGTATTATAATGCTTGTATTATTGAAATTGCTAACAGGCAAACATGTTTAAGCTATGATAGTGAAAATCATAGAGCGTTT
TTGGCTTTTTTTTGCGTTtgtgcttcggcttcggtCCAGGTTTCAGCCACGCCGATCCACACGCTTGCGGTCGCACTGGAACTGGGGATCAGCAGCGAAC
TATCCGACTTCAAGGTCACATTCGTAGGTGTGGTAAGCAAGCAAATGTGTAGGTTTCCTGAAAATGTCCAATGGACATCCGAGACGAATCCTACAACTCC
TCGATCCGGCGCCCTTCGTTCGTAGCAGCGCACACTGCATGAATACAAGGAAATAGTTGATCTTGCCAATTCACACAAGTGCATGAAGATCCGGAAGGTC
CACGAGTCGCCAAGTGTGGATGTGACCTTGGCGATTTTGAGGACCAAGATGCTGAACCGAATATGCACCTTCCATCAGTGACGTTATGGCGCACATTCCG
GCGGCCGTACTGCGATCTTTAGCTGTTTCTGCAATATTGGAACGAGGCTGTCCACATCGCGTGCAGCTATCCAGTTCGCAGCCATCTTTCGCATttcggc
agcaagctcaCTCAATTTTGTGAAGTACATCTGAAACGCATCCAGTGC