Description :
From Genome Similarity Track
Location :
Scaffold_7:1002564- 1005265
Sequence
2701 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCTTCATTGACTTTGGAAGGTCGATGGTGTACTACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAA
ATATACTTAAGTTTCCTCTTCCTTGTTTGTCTAAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCTCCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCAAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGA
GCGCAAACTCAACAGCTGAAAGCTGCGACGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTTT
TGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTC
GGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTTCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGC
AAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGAC
TTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTGACGTATCGGG
CGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTC
CGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCA
TATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGT
CCCGATACGCCATGCGTATCCGGTCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCAC
GTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCC
GTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAATACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCT
TGTCATGGACACGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACA
CCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTG
TCAGAAGCATCCTGGTGCTCTTGTTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACT
TGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGACCGGGGTGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCG
AACGCCCACGTTGCTGACGAAGCAACCGAGAACTTAAATCTCTGGTGACGCGAAAACGCATTTGTCGATGTTGGCGTAGAGCTTGCTCGCTCGCATCACG
TCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGA
AGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTTGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCTTAAAGCATGCC
GCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGATAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCG
GTCATGTTGTTCAACAACACACCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTC
CGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGAC
CTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGT
T