Description :
From Genome Similarity Track
Location :
Scaffold_658:10022- 18356
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_658-fgenesh-gene-0.2Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_658-fgenesh-gene-0.3Pc20g04080 protein
Pytir_DAOMBR486maker-pir_contig_658-fgenesh-gene-0.4HCG1818127

Sequence
8334 bases(100 bases per row)
TGCGTGTGCCTGCGTGTGCCTATTTGCATTTGTGTGCGTTTGATGGAATGAAGACAGTGAAAAATCATCCGTGAAAAGGGTCCAACCGTATTGGTACGCG
ATCCTTTCTGTGAGCATTTTATTATGTCATAGTTACACTGACCATCACAAGTACTTCTCACCACTAGCTAGCCGTCGTTGTTCTGCACTCGATAAGCTCG
ATAATCCATTCTTGTTCACATTGTTTCCAACGTTGCCTTGAGAACTTTCAATTTGCCTCCTCCTCATCGATTCCAACTGCCGAGTCCGCTCACCGACCCA
GCATTCGATGTCGTGGACGTGGAACTCTTCGTGCGCACGAACGATTTTCTCCGCCCGGACTGCGCCTGCACGCGCGGCAGGAGACTGAAGATGTTCCAGC
CTTCCAGCACGCACGTGAGCCCACTCGTGCCGGCCTCGGCGCGGATCACGCTCACGCCCATGAGATGCTTGGCGCACATGTCGTAGAACTCCAGCAGTTC
GTTCTCGTGCACGTCGTCCATCTTCATCTCCCGCGACGATGCTGGTTTCTTCTCGCTCCTGGCGCTGTCTTTTTCTTTCGCCCCGTCACCTACTCCAGGC
AAAGTTGTCTCTGGTCGAGAGGAGGACGAAGATAAACCTGTACCTGGAACATCTCCTGGTGGTCGCTTGTGAGACTCAGATGTTGACACGGGCGTCACGA
ATGGAAACGACGCGGCGATGGAGTGTTCCAGTCCAGCAACCGAGTCGTCCGACGTGTGAGGAGCTACCGACGACCTTGATGATGCACGCGACAGATTTCG
GGTGATGTCAATCCCCTGCGCATAATGGGTGGCTCCAAACTCGGTCCGGAACGAATCGCAGCCGCTTTTCCACTCGGATGCAATGCCGCCAGGGGTGGTC
GCCAAGTACTTCGCGTGTCGGAACAGCTTGGGTGAGAGCACGCTCGCCATCCACCGGTTCCCGAGCAGCGCGTCGTTCACACTCGAGAACGAGAGCGTCG
CGCTCACTTCTTGCGAGAAGCCCAACACCTCGGCGACCTTTTCAACCCAACCGCGGATTCTGTAGAACTTGTCGCCTCTTGACTTCTCTTCAGCAGTAGC
AACATTGTTGAGGTGGTGAGTCTGGTCGTCACTGTTGCCGCTCGCGTGTACACCTGCAAGTTGTGTTCTCTTCACCGTTTGCTGCTGTTGTTGCTGCTGC
TGCGACTCTGCCTGCGTCTTCTTCTCTTTCTCCTTTGCGAGAAACTCGGCCTCCTCTGCTTCTTGAAGCACGTCGATTTCCAGTTTCTTCGCCAGCTGCA
CCAGAATCTGAGCCCACGCTTGCTTGTTCAATCGCGCATCAAGCTGCAGGCGGCACGCCCACTGGGAACCAAAGTCCAGTCGCTTGCTCGTCAACACTTC
CTCAAGTGAGTGGCTGCAGAGCATTCGAAACGAGAACCGCTGCAGCAGGTGGTCGAATTGCATGGACGACGGCAAGTGCAGACTCTGCATCATTTGGTAC
AGATCCATCTCACCACTGAACAAGATCACGATGCGAATGACCATCGAGCTGGAGGCAGAAGATGAGGACGATGAAGAGCTACTGCTGACGCCGCCACTGG
AGCTTCCCGGACCCGAGCGAAGTTGGAGCTTGGAGGGTATCGTCACGAACCACTTGTGGAAGAACGGCAGACTCTCCAAGTGATCGTGAAAATACTCATG
CAAGAACCACGAGAGGCGCTGCGAGATCCACTGGATGTCGTTGTCTACAGCAAATGAGGGATAGAATTTCGTAAGGTACTCATAGAAGTAATACGATTTC
CAACTGTCAACTACTCTCTTTACTCACCTTTGACCCTGCTTCGGCACGTCAGGTCCACGTACACAAAGCATTCGGCGCCTCGCTCCAGGTACTTAAGCTC
ATGGAGTGTTGCCGCCGCTGTCGTTGCACATTTAGACAAGTGAGCTCAGGTCGGCTAACCTCCAACGGCCTGCTGTATGTTCCACTTACAGTCAGCATCG
CTGTTGTAGGACACGTGCACAGTCGCGTGCGACGAGAACCTCGAACCGACGTCCATCTTGAGCACGTAGTCGCCACGCTCTCGCTGCACGTCCGACATGA
GGCAGCTGGCTCGCAACAGCCCTGTTCGCGCGATCTGTCGGATGTTGTCAAACGCCCACGAGGTCGCGCGCTGCCAGCGTCGCAGGGTTGTGAACGACCG
CAGGTGGAGCTGCATGAGCCAGCTGCGCCAGCGCTGTCCGATAGAAATGAGAAGATTGTTAGTAAGTATCGAATAGTCATTAGTTACCAACAACTGTCGG
TGCTTTGCTTACCGTTCTGTGGACTGGTGTCCAGGACGAGAGCACCAAGCTGAGGAACCCGGGCTTGCAGATCTTTGGCTCATCCGCCACTTGCGGGTTC
GTGTACAGCAGATTCGACTTTTGGCGGTACCCAAAGAGCCGCAGTGAGCGCTTGCGGTTGAGCACGCTCTTGAGGCAGCGCGCGAGGAAGCGCTGGTGCT
GGACCATGTCGCAGAGCTCTTGCAGCGGCACCGCGTGTCCGCTCTCTGCGAACAAGTAGTGCGCCATCTTGAGCTCCACGCCGCCCTCTGCGTCCGCATA
TTCGTCGAAGAGTCGGTTGCATTTACGCATTTTCTTGAGCCCTCTCCACTCGGTCGGGATCTTTAGCACCTCGAGGTCGTGCTCAAAAGGTGTGTCATGC
TCGATCGCTTCACGGTACATCATGAACCCCGCGAGCGTAAGCCGGAAGTACGCGTCTGTGTCAAAGAGGTCGCTCATGTACATCTGCCACATCTCGGAGT
TGTCTGCGAACGCGCGGATCTCCGACCGCTCGCGCTCCTGCTCTAGTGCTGCGACATACTCGAGGAACTCTCCGTAGCTCCACGCGCCGTCCTCGTCCAA
ATCGAAGCGTGCAAACACGACCTCGCACTTCTCCTTGCCGAGCGCCGAGAGAGTCCACTCGACGCGCGTCGCGTCCGGCGGGTCAAAGTCGAAATGCAAC
GCCTTCTCTCGCTGCAGCTGCCCATGCGAGATGCGCTCTCGATGACATCGGAAGAGGCGATCGTGGATCGTCGCGCCGACGAAGTCTGCCGGTGGAGGCT
CCAGGAAGTACGCCGAGTCGTAGCCACTCGTGACGGCGCCAGCGTCGCGAAGCGAGTTAGTCACGGTGCGTAGCTTACTTTTGATCTCCCTCTTGCGCTC
CTCCAGTGCCGTGAGGTTGGCGGTCCGCATGCCCAGCGCATCGTCCGCGTCCAGCTCCATGCTACTCTCTGCTTTTCACGTCGCCATTGCTTTATGGTTT
GCTTTTCGGTGTGGCTCTTGGTGATCTATCAGTGTTCCAGTCAGATATCTTTTCCTTTTCAACCAATTAAAACTCATTATTGGTCATAAATTTAGAATAT
CAATATTTGATTGGCTCAAATAGACTGGCAGCTTGTCATGGGGAGAAAAATGAGAGGCACTTTCGAATATTCGCTCAAGAGAACGAAGAGACTAACAAGA
AGAGAGAAGAGAGATGGAGAAGGCCACGCTGTTCAACGCACTCGCGTGGATCGACGCCAAGAAGAAGGACGAGCAGGTGGACACGGAGAACGTCGAGGTC
GGCGTCCAGTGTCTCGGGTGCGTGCCTTTCTTTGCCTGCTCTTGCGGCTCGTAATGGCTCGTAAAAGCGTCGCGAGCAAGTGACATTTGGTTGACACCAT
CATGATGATGACACGTGGGCTCAAAGGGGACGTTGTCTCAAAGGAGACGTGGGCGATTGTTACTGACCTCGGTGTATGCATATATGTGACTTTTCGAACG
ATGTGAATGTGCTGGATGTGCGCAGTGAGGCGTTTGGCTTGAATGTGCACGACGAGCAGCTCAAGCGCACGTACGCGCTGAGCGGATCCGCCACGTTTGA
AGATGTGTTTGCCGCGGGCTTGAAAGCGCTCGGACTCGAAGTTGGCGTCAAGGTAATGTCGCCTTACCACCGATTCTTTTTGTCCTAAGACGTTGACACA
TTCGTATGTGTACCTGGTGATTGCTAACGTATGACTGCTGCTGCTGCTGCTGTTGGTGTTACTGTGCAGGCGGCCCTAGTCGACTCGATCGATGAAGACC
CAGTTGTCAAAAAGAGTGCGTATTTTGTGTCCTTTCACCCGTAAATCCTTCTCGACACTAATACTTACACCACATTCTCACTTGCTCTCTCTGCGTGAAC
ATTGGCGTGCGTATAGACCCTGATCTGTGGAAGAAGTGGGTCGCGAAGCTTGAGGAGAAGAACTTTTTCAACAATGCGCCAGTGGGCTCGGAGGAACACA
CGAACCGTTTGAAGAAAGCGCTCGCCAAGTTTAAGGAAAAGTTTGGCGACGTGAAGAAACCGGCTGCTGCGGTGCGTTTGCATTAGTGCTTGTGCGTTCA
TGTGATACGACCTCACTAATGTTGGAATCTTGTTGTTCGTGTGTGTAGCCAACGTTCTCGAAGGCCGAGAAGGAAGCCAAGGCTGAGGAAGCCAAGGGCA
AGGGCAACGCTGCGCTGAGCGCGGGCGACTACAAGCAGGCGGCGGCACACTACGAAGAAGCGCTCAAGTTGTCGCCTTCTGGTCCGAACTCGCACATCTA
CCACTCGAACCTCGCGGCGGCGCTGACGTACCTGGGTAAGTACGACGAAGTGATCGACCACTCGGAGCAGTCAATCGCGCTCAAGCCTGCGTACGTGAAG
GCGTACTCGCGCATGGGCCACGCGTACGTGCAGCTCAAGGACTTCGACGGCGCTGTGGACGCGTTCCGTCGTGGCTTAGAGGTCGACAGCTCGAACGCTG
CGTGCAAGGACGGCTTGGCTGAAGCCGAGCGCAAGCGCCGTCAGCTCCAGAGCTCGGCGGCCCCATCTGGTGGAGCTGGTGCCGGAGCCGGTACTGGAGC
TGGTGGCATGCCGGACCTGAGCGGTCTTGCGAGCATGCTCGGTGGTGGCGGCGGCGGCGGTCTCGCTGACCTGATGAGCAACCCAGCGCTCCAGCAGATG
GCGTCGAGCATGATGCAGAACCCTGCGATGATGCAGATGGCGCAGAACATGATGCAGAACCCGGACATGCTCAGCAGCATGATGGGCGGCATGGGTGGCA
TGGGCGGTGCTGGTGCCGGGGCTCCTCCATCCTCTGCTGCTCCAGGTGCTGGTGCTGGTGCTGGCGGCATGCCAGACATGAGCAGTCTCATGAACAGCCC
GGAGATCGCGGCGGCGCGAAGCGACCCGGACCTGCAAGATTTTTTCCGCGACGTGGACACGCAGGGACCGTCGGCGGCCATGCGTCACATGTCGAACCCA
AAGGTCTCGCAGCTGCTTCAGAACGTCATGTCGAGAATGCAGTAAACAACTGAGAAGAGGGAAAGAGAGCGAGAGGGACAAGGCGCTCACCTTTTTCCCG
TACAGATCCAGTAGATAGGAACGAGAAGCTACAAAAAGAAGATATAAAGCAAACAAGATCTGTGTTGGTTTGTGCGTGCTTGGATATGTTGATATTTACG
GATGAGCTGCGCGTGGTTGCACTGTGTTCATTGGCTGGTGTGTCTGTCTATTTAGTTCTTGACGAACTTTTCGGCGCTCTCCAAGAACGACAGGTACTCG
CGCTGCTCCTTCAGGTCTGCGTACTGGGTGATGAACTGCGCGAGCTCGTCGTCGATCTTGCGCTCAGCCAGGTAGTCGTAGAGCTTCTCCTGGACGTCGA
GCTCCAAGTCGGCGAAGTTTGGACCAAAGTACAGGCTGTCCTTCTCGGCGTCGGCGGCAAAGTCACTCAAGTAGCGCACGCGCTCGACTGTCAGATTGCT
GCTCGCGACACACTCGAACTGGAGGCCCTGGTTGGCGCGCGTGATGTCCACGACGAAGCGGATGCCCGGAAGCTCGTCCTCTTCTTCGTCGTCGTCCTCG
CTCTCCTCCTGCTCGTCAAAGTTGCCTTCCTCCTCTTCGTCAAAGTCCTCGTCACCCTCGTACTCCTCTTCGAGCTCCACGACGTCCTGCGAGTCGAACT
TCACGCGGATCAAGTCGTCGCCGATCTGGCCCGTGAGCACGATCTCCATGCTACCCGGTGTCTCCTTGAGTGTGAAGATCTGGTTCATCTTGGCGTGCAG
CTCCTCGAGCTCCTCACCCTCAAAGCAGTTGCCCTTCTCCTCTTCAATCTCACGCTATGGATGCATACACATACGATAGACAGAATATACTGTTAATGCC
AATGCTCATTGTGTCATGACTCAAATTGAGCTCGACGCACCTTGAGCAGCGACGTGAGCGTCGACTTCTCGCGAGCCTGGAGCGAGGCGCAGAGCGCTGG
CGCCACGACTTTGCGCGCAGCGAAGGCGACGGTGGCGCGCTTGGCAAGGGTGACGGAGGCGGCACGGGCGGCGCGGGCGAGCATAGCTGTCTATCGGCGG
ATCGATCTGCTTGGCAGGTTGGTTGCGTCTTGCGGAATGTTCAAGCAGAATGGATCGGTGCTGCGAGCCACGTAAAATAGGCTGTATGATTGGATGAAAA
TTAGAAAAAGAAGTGATGTGATTGGATGAAAACACGCAACAGTCAAGTTTCTCGAATCTTTTTCTCGTGCACGCAATGTTGGTGGGTAACGCTGTAAAAC
CTTGTATTTAAGGTTTTATAAGGAAAGCGGATTATGCTACAGCCTGTAAATGTCATTCGCAAAGAGATTGTTCCTTGAAAATGCAGTTTGACACAATCCA
GGGAAAAAATATTCTATACTAAATACGATTCTGATTGTAGTATTATCCTAAAATATTTTGGGTTTGAAGAGCTGGACGCATCAACCAAGACTGCCCGCAT
TTGCCAACAAGGACATCCAAGCAGCAAAATGCACTTCCTGTGTGCATCACCAGTGCGGGATGAACGCTTGTCTGCGTCTATAGGTGTATGTGTGTAAGTA
TGTGAGTGCTTGCGCTGTGTATGGTGCGTGAACGTGCGTGTGTATCTGCAACGCCAGTGTACATTATGAAACAGGCGCTGCGCACATACAACTAACTGGA
TGGCAAGGATGACAACTCATGATTATACATTTTGCTTCTTGATTGGAGAAAACAACTATCCCCGTAATGGCGCAACACCAGCAGAGCGGACGCTGAAGGC
CCACCATCACGCTCTGCTTGCGCCCGCCTACTCTATGGCAGGGGNNNNNNNNNNNNNNNNNNNNTAAAGTACCAAAGGCTTTCCCTGAAAGGCTGAGGAA
GTGCGTTGCAAGCTCAACGCCGCTTCCAGATGGCTGGAAAGATACATGTGTTGTGCTTGCATTTTTTTTTGACAAGGTGGTTGGCCTTCCAAACTGAGAG
AAACAAGAATTAAAAGGCGAAGCTGAGTCATCCAGTCCAAAGCCCAAAGCTGCGCGTGTGTGTATGTATGTGAATGAGTGGATTGACATTGGTGCTCTGC
ATGTTACTGAAGAGACGCGATCTCGTAGAGAAAGACGCTCTCAAATCCCTTCTGGCGCTGCTCTCGTATTCGTTCAGCCCTATCATCAGAGCTGTCTACG
CTGTCAACGCGCTTGTCTTCAGGCAGAAATGCCGCAGTGTCGAGCGCGTTCGCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGCAGCGGCGCG
ATCGACCGCGTGATACTAAGCATTTTGAAGACCATTCAGCACAAAAGCAGTCAGTAAAGTCAGACTGGGACTCAAAGTTCAATTCGATAATCAAGTTACT
ATTGGTCAATCTATACCTTCGCAACTGGTACGTGACGTAGAGCTTGCATTTGGGGTTGCACCGGAAGATCAGCGCCACGCTCGCGATCACCTTCTCAAAG
TCTGTATTCATCATTAAGCCATATTGACTCAGTTAATCCACGACCAGCTCATACAAACAAGCGTATCTCTCTCTCTCACTACGTCTTACCTTCGGACTGA
TAAAAGCAATCGGCCGCCAAGAGCACGTCCACAGTCTGGAACATGCTCAAGAGCTCCTCGCTCAAAGCCATCTGCCCCCAGTCCAGCGCCAGAAAGCGCG
CGATACCCTCAACGCCGTTGAGCGCAATGTTGGCCTCCACATTACACTGGATATCGATCGCATCGGACCGGTCAGTGAGGAACACTGCCTTTGGGTCACC
GCACACGGCAGCGAGGATCCCCGGCAGCCCCGTGCCGCAGCCAATCTCCATCACCACTTTCTGCCGCACGAGGCTCGAGCGATAGCGCGCCACGAAGTGC
GCAAGCACCATTGCAGATGGCCAGATGAAGAGTCCGTAGTGGGTTGTGTCGTCGTGGTCGCTAGTGTCCTGGAGCTCTTGGATGAGCTCCACCATGCGCA
CATGAGCAATGGCGCGACCCTTTGACGGCGCTCG