Description :
From Genome Similarity Track
Location :
Scaffold_558:10021- 16720
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_558-fgenesh-gene-0.2P-type ATPase (P-ATPase) Superfamily
Pytiw_DAOMBR242034maker-piw_contig_558-snap-gene-0.3Conserved gene of unknown function

Sequence
6699 bases(100 bases per row)
TGTAGCGAAGCCCCGCAATCGTACACTTGGCGAAAACCATCTCGTTTCGTGTTAACGTGCCGGTCTTGTCTGAGAAGATGTACTGGATCTGGCCGAGGTC
TTCGTTGATGTTGCTGTTGCGAACTTGCGCCGGAGTGTCTGTCTTCGGGTCGTACATCTCGATATCGCTCTCGATGTACCGCGCGTGCACGAAACGCACG
CCTTCCATTGTCACGTACATCGACAGCGGAATCAGGTTGTTGAACAGGATCACGTAACTCAGGAAGATGTAGCCGTTCTCAGTCGCCTGCCCAATGTACC
ACGGGGTACTATCGTCGTCCAGTTCCCAGCCCCAGTTGTTGTTGCCAAGCGTGCACGCCACCGAAATACCGAACAGCATGACGAGCACCAGCACGAACAT
CGTGTCAAGTGTCTTCTCCACAAAGCTTCGCTTCAGCGGCACCTCCGACGAGTTCATGGCGATCTTCGTATCTCTACCAGTGTAAATGACGAACGCGATC
GTCCACTCGGAGTTGCGGCTCTCACTTCCTCGCAGAATCAAATTGTCCATGGAAAGACTCGTGTCGTCCACGAGCTCCGACACCTCAGTCGAGCCCTCTT
CGGTTTTCGTGTCAATGCCGACCACCTTCAGCACGCCGTCGAAGTAGAACAAGTCTTTGTTCGGGGCGTCGCACTCGACATGGAGCTTGTATTTGTCCAA
GATGTCGTCCGCAGTCAGGAAATGCTTGGTAGGCTTCGCCACACTCCGAATTTTCAGGTTCGTCTCGCCATCCAAGTTCGCAGTCTCGATGTAACACCGG
CCATCCGGACGGCTCGTCGCCAGCAGAATGCAGTCTGCTGGCACTTCGTCGCCATCTTTGAGGATCAGCATGTCGCCCACTTCGATATCCTGCCACATCG
CATTCATATGTTTGATCGCTCCAGTCAAATCGCGACGGACGATATGCGCTGGCTTGGTATTCACCTGCGTATCCGCTTTCTGTCTCCGCAGGTCCTCCGA
CACATCCTTTAACGCCGAGGTCGCAAACACGATCAGCAACGGCGTTAAACTCGCGACTGGACTCACGGGCGAGAAGCTGAAGAAGCAGAGTCCGACCACG
ATCGTCGTGTAGATGTTCGCGAGGCGGCTGAACTGCATCTTGAGAAACACGAACGGGAAGTTGTAGAACGTGTACTTGCTCGTGCGGATCAGATTGCCAC
AGAAAGGCGCGGGCACATCAGCAGCATTCCCGTTAGCACCACTAGCAAGGCTCTTGCGTCGACTGCCAACTGGCGGTACATCAGGGCCGACCAAGATTGT
TCGTCTCGCTGCGGGGCGCTCGTCTTCAGGCAAATCCGCGACAGGATTCACACTCATCGTCTGACGCAGGTGGTGCATCGATCCGTTGCGCGCCGCTGGG
GACGGCGGCATCATCGTCGCGAGCGCCGCGCGGTCGCACTCGCGCTGGTTCTGCACAGCCTTGACGATGCGTCGGAGCTTCCACCCGTAGAGCAGACCGG
CAACGTTGAGCAGCGTTAAGATGATTGAGAAGAAACCCTGCATGAGCACGGCCGTGCCGCTGCTGACACTGTTGAGCTTGCCGTTGTAGCCCTTGAAGTA
CCAGATCACGTCCACGAGCAGACTCAGCTGCATACCGATTTTGTAGAGGAGCAGGAACTTGGGCACGAGGAACTTGGTGCCGTGCCAGCCGAGAATCAGC
GTAATGTACTGCACATTAGATACGGTAGGTTAGCATTTTTACGACTGGCGACCATCAATAAATCCACACAAAGAGACGAGAAAAGACACAGAAACGTACC
AGGATGAGCACGGGGAGCGTCGCCTGGTACGAGAGGCCGAGGATGATGGGGAAAATGCGGAACGTGTTGACCACGGACTGCGTCACGATCGTGAATTTGA
GCCGCCGGCGCGCCTGGTAGATCGTCATGCCCTTGAGGAAGCAGAAGACGCGCTCAAAGACGTTCCAGACCTTGGCCTCGGCGCTCGCCTGGTTCTCGGA
CGCGATCGAGTCGGCCATGCTGTCGGCGCGGTACCGCAGCGAGATGATATTGCGCTGCTCCTCCTCGGGCACGGCGCCCGTGAACGTGTTGAGGCGCCGC
ATGCCTTTCTGCGAGTTGGGCGGCTGGGACAGCGGCGGCTGGTCATGGCCGCGGCCGCTGCCGTTCGCGTCGATCTCGATGCCCAGGTGGTAGCTGCTCG
CCGCGTCGTCCGAGGGCGACTGCACCGCGAACTCCACCACTTTCATCGCTCTCTCTGCTCTTCTCTGCTGCTGGTGACGGAGTGGAGTGGGAATGGGCCA
GAACGTGAGTCTGCCTGTCTTTCTCTCTCGAGACACGAGACGCAAGACGCTGGCTCGACTGACTGCGTGCGGGTGTCGTCTATATATACAGCACGCTGTT
GCGGATCAGGAGGCTGCGTATAGATAGAAACACACACGCGCTCTCACCTCCGGTCTCTTCTTCCTAAGTGTCGATCGGCGCGTGCGGAATGCAGTGGAGA
ATGGCGATTGATTGCATAGAGCGAGAGAGAGAGGGTCGTGGGAAGCCTTTCATGAAAATTGACAATCCGTCGACGGGCCGATGGGACTTTTTGCCAATTT
CACATACAAACGTCATTGATATTTTAAAAAAAGGTACTTAGTCGAGTTGCAAGCTAAAAAATCAACTTTTAGTTACGCGACAAGACGGTCGAATCTCGGC
TGCTAAAAGCAGTGTCTGTCAAAGGCGGATAGCATTTTACTTGGTTTTTCAGTGGAGTCGCGCTCTATATGTTGTGTGCATTTATGTCCAGAATACACTG
TTTATAGGATATCACAATTACACGATAGCAAACATGACCAAAACTTGGTCAAAGCAGGTAGCGTAATCAAGGCGAGAGTTCTGCATTGTCATTTTTAACA
AATGTGAGCCAGCTAAAATTGTCCCACCTGCTCAGTTTTAACCTAAAACTAAGACTTTTAGGCCTCAAATTGTCCGAGGGAGCGAAGCCTAATAATTAAG
CGACTCTTTTTTCTCATCGACATGAGACAACAATTGCAACACATCAATTTGACAACCACTAAATTCGAATGTTCCTTCTAAACTCTGCTACGGGCCTCTT
TTTTTCGAATATGCACATCCGAATGTAACAATTTTGATGCCATTAAACCTCCTTATAAATAGAGAATGCCCTTTAAAAACATTGCGATTAACAGCAGAGA
AAAGCAGAGAAAGGCCACTTTTTTGGTCGTGGTGGTTTTTGAAGACAAAATGTATTTTTTTGTTAAACTCGCTGTCTCAACAACTCTCAACATCCCGCAG
CCTGCACAGCAAGAGTCTGTCTGCTCTGTATTCTCCACTCTTCGCTATCATTTCGCTTTTTTGTATCACCTTTAGAACACGCTGAGCTGCGAGATCAAAT
ACGTGTCGCTCTGGCCTGAGGCGGCGGGCTTCTCCGAGTCCTTGCAGAAAATATCTCCGACGCTGGTCCCGTCAGAGCACTGCGAGTCGATCGCCAGCTG
GTCCTCGTACTCCGTGTTGTCGCTGATGGCTACAAAATGAGAATCAGAGACATGTCCAGCGAGATCAGAAATCCAATATCCCCACCAAGTTCCATCACGC
AGCCCAGGAACGCACCGTACGAGACGCAGCCCACGATCCAGTGCGCCTCGCTGTACTGCTCGGCGGCCGAGACCGAGCGTCGATTGCGTCTTCTTGGCGA
GCACGAGCCTGAGCCTAATCCTGAGCCCAAGCCAAGCGCCTCGTGCTTCTCGAGCACGGCCAAGAACGTGCCACGCGTCACGGGCTTCACGATACTGGTA
CTAACTTTGGATGGCTTTTTCAATTCTCGCCAACAAATTTGTCATCGAAAATGGCATTTCCGTGATTTTGTCCGATTTTTTTGGGTTACTAACTACCATT
TATTTTACATAAATAGACGTGTAGGCTGCACTTAAGAAATGGATAACAGCATGTGCCAATACGGAACTCAAGTCAATTTTGTAAGGCTAGATTATCGATT
TTTACATGAATAGACGCGAAAACAAACAAGAATCTAAGAAATGAATGGACGCCAATCAGCGGCCGCTCTTGCGATTTGTTCGTGAAGTGAGCCGAGAAGA
CGACGTGTCCTTGTTGCTCCTGCTGCTCCCTCGCTATCCTTGCTCTCGCTGGTTTCCTGGTTTCCAAATGTGAATCTTCGTTGCTCTTCAAGCAACGTAT
CATTCCTCTCTTTCCGAACTGTAAGTTGCTGCAAAAGCTTCACACCATATTTACTTCTCTCCAAAACATGTTCCTAAATCACAACTGCCCTCATTTCCAT
CATCAGTTATTACAACTGCCCTCAAGTTTCCATGGCTGCATATGATTGGCCAATATAATCTTTGTTTCATGTTCGTATTTTGCAAGGCAGAAAAAGCAAA
CGAGAGCGACGAGTGACGAGAGGAAGGACGCAGCGCGCGAGCACTGAGATGGAGAGAGCGAGCACTGCTATCGTCTCGGCAAGGTGACAGAGATTCAGCG
CGTGTTCGCAGCACACACCATTACGGTACGTGTGTTCGTAGATCATGCTACTTAGTGGCATGTGAGCCGCGCCATGCTCCGTTGCGTCGAGGAGAGCAGT
GACACATGTCGCTTTATAATGTGAGTGTTGCTGCTGCACCATTCGAGCGAATGCACTCACGGATTAAATATTGATTGTGTAATTCGACTGTTCAGGGTCT
GAAGCGTACAATTGATGTTCTGGCGCTCGATTTTGATGTGCTCTGTGGATCAGCAAGGTGAGCTTTCATGAATGTATATAGAGTAGTGGTCAGGATGGAT
TGTTGACGAAGATATGAAGTAATAGAGTGGGCGCCGGCATGCAAACGAAGATCCTCCCAAAGTGACCACGAACTGGGGTCGGAGGGTGTTGTAACTTGCT
CTTAGATATTGAAAATTTGTGAAAGACTGGGCGTCGACTTCAAGGACGTGATCGAGCTCAAGTACAAGAAGCGGTTGACGGCGTCGAGGACGTGATCGAG
CTCGCAATTGCTTCGTGAGAAGCTGCCGAGCTTCCTGTACGATAGTCTCCTCCTCCACCTGCACATCATGAGTGCTGTGATCGAGCGAGAAAGCAAGGGT
GGTAATTCGGCCGCTGGAGGAGCTTGCAACAAACTGGACGAGTCGGCGGCTGACGAGATTGGGGAAGGCGCTGGTGGCAGCGGCATCCACGACGTGAATT
CGATCAAGAAGGAGGAGATCCGGCCGACCGTGGGCACGCTGCTGCGCGTTCGCGAGCACGAGGACCCGAGCAAGGCATACTCTTCGGGCTACCTGTAAGT
TTTACACAGAACAAATCTTGATCTGTAGAGCGATGCGCTGTACACAGACGACGACATCAACTTTGAGTTTTCATATTCGAGAGAGAGAGATTGCTTTGAG
TGGATGAACTGAACCTCGAATAAAAAGCGCTATGCTGCGATGAACGAACACATTACAACTTGCTCCGACTACGGTATGTGATCGTATATAAACTCAAACG
TACAGCGCGCTATCTTGCTCTTGTCTGGTTGGGTTTGTGAACTTAGCACAATATTGTGAACATTGCTGAAGGATACTGAAAGGCACAGTGTACAATTACT
TTACTTATTCGCAGCAGAAGGCGGCCGTTCTTGCTCAGCTGTCAAGAATGGGCAATGCCCTACAACGTACCGCCCTGGATGAATTTTGCTATTGTCCTCT
TCTCGCTCCGACCCGCGGTTTTCTTGACAGCGCCTTGCGTTGTGCCCAGTCCTCTTGCAAATCGTACACTTATCAGGCAAGCGCTTCTTTGGCAGTGGAG
CTTGAACTTGGCACGCAAATAAGGCGACGATCTCGTCATTGCCAGAATCTGATGCGCAGACGCGTAAAATGCCCCTAGCTTGCCTTTCAGCCATTGGAGG
CTCGCCTCGATTTGAAACGCGCTTTTTCCTGGTGCGGCGGTCCTTGGCGCTCTCAAAAAGTCTTGGGCGTCCAGCATGCTTGTAGATGGGTGGTGGCTTG
ATCTCAGTGGTCTCGATCACTTCGTGCGGAAGTGGAGTCGATACTAATACGCCAGTGAAAGCAGTCGCGTAAGTCGCTACAAGGTATGTCGGGTGGAAGA
AATTCTCCATCTGCGAAGTCGAGTGTCCAGCTTTGATGCGCTTGTGCATCGCAGCGAGGATGTGCTGGCAGGGTAGGGATATCATCTCCGACCCACTGCT
ACGCTCACACTTGTTCTCTTGAGTGTTAACTCTGAAGTCGACGGTCGCAAACGCTGAGGCTGAGCTAGCAGAAGCTATCGAGTCGCGAACGGAGGCAGCT
GAGTGGCGTCGTCCAGGTAGCTGAGTTTCTTGTTTTCAGCTCCTTGTCGAACAACTCCTTCGTCCTCGGCGTCACGTTCGTCCCTCGGGAGACCCAGTCG
AGAACGGTGGCTCGCTTTCGACAGCTCAGTACCATGGCACGATTGCAGAAGGCCACTACCGCCTGGGAACTTGGTACCTTCTGCAGTGGTCCGCAATAGC
GCATTATGTTCATCTCGCTCGCACTGGTGGTCAGCGAAGCCACAGACCACGGGGTACCCAGTTTGGCTATGACAAAAAAATCTCTGTACATCGCCAAACA
CCACGAACTAATGTTCACACACTAATTATCATCTTTACACTCTACAAAGTGCCTGCAACTCGAATGCGCGCTTTAAGCCGAAAAAAGACATGCTTTCTC