Description :
From Genome Similarity Track
Location :
Scaffold_2497:1002- 3728
Transcript NameFunction/comments
Phyta_totarag14553hypothetical protein

Sequence
2726 bases(100 bases per row)
TCACTTCGCGATCTCACCATTCCTCCTGATCTGCGACCTCCTCGCAGATCCTTCACCCAACCACTCACAAAGTGACCAGCTCACTTCATGATCCTGCTGC
CTTATTGCTCCTCGTGCGACTGCATGGCCTTAAACCGGTTCCGGTTGGCCTGTTTGCGCAGGTAGTCGTGCAATACAGCTCCGCAGTTGAGATCGGCTTC
ATCCACCCATGTTGGTTCAGAGTATCCCTTCCAGTGCACCAGAAATTCCCGTAACGCTCGTCCGTAGCGTGTTCGTCGTCCAGATCGCATTTCCAGTGAT
GCGTTCGACCTCGtactcgtcatcgtcaagcTCCGTTTCCCCACTATCATCAGGCAGCAAGGCTTCATCAAAATCGaatcgatcttgatcttggacagCT
AGCCGAAGCCGCGGACGGTCCGGGAAATTTCGCACGGGCTTAAGCTTCGATCACGGGAAAGAGGTTGTACGTCGTGCCCGCAATCTCCAGTCGCACGGTG
TgttcgtcgatcttctcgaccACTCTGAATGGTCCGTGCCACATGTTCGCTAGCTTCCGTGCGTAGCCCTGTCCAGGTATAACTAAACCTGGCTGCCGAC
TTCGATCTCGTGCGGACGCACGGAATCGTTATGGCGAGCNCGTCTGCGACGTACATCTTCAGTGCTCGCGTTAGCGTCTGCATCGTCCATTCAGCCGTAC
CGTTCGCTTGCGGCCGATACGCCGTAGCGCTCGTTGTCGGTGTCCGATGATCTTGTTGAACGATCTGAAAAAGTCAGACATGAAGCCTGGCTCTCGATCG
TGCCGGATTGCTTCGCTTGCACCAAATCGCCGGAAGACGCACTCTTCATAATTCTCCACGATCGTTTGAGCAGTTCTCGATGCACTTGCCTTGGCGATCA
CGAAGCCGGTGAAGAGATCGACCCAGCTCAACAATTCCGTGTTGCCCTTATAAGATCGGGGCAGAGACGGGATGTGGTCCATAGCGATGATCTGAAATGG
GTACGTCGCTTGTAAGTTGCCCGGTGACTCACCTCGAACAGTTGGTCTCCCTTTTCCAGTCTCACAGTCTATGCACTGACCCACGTAACGTTGCCCACCT
TGATACAGTCCTCTCCAGTGGAAATGTGCCTTGATCCGCTGGTATGTCCTCCCGATTCCTTGATGTCCACCTTCCAGACTGCCATGGTAATGATGTAGGA
agtcttcttgcagcgtctCAGGAATCACCAGTCGAGCAACGAGATCAGGATCTTCATTCGATTGCTTATACGGCGGGCAGTAAAACAACAAGCCGGTCTC
GTCGATATCATAATCCTCAGCGATCTTAGCGCAGGTCTTCGCCTCTAATGAGGTAAGTTCCTGTACGTCCCCTCGCAAGTACTGCTTGAGATCGACGATC
cacttttcttcgtcttgtgcCATGCATATTCGCTCTTCCCTCATTCTCTGAACAATCTCCTCCTGTAACAATTCTGGGCTGCGCCGCTTGCGCGACCTCG
TCACGGCCGTGATTTTGGTCACAGCACTGTCAGATCGTGGGATCAGCATCTCGTCAAGACGGTTAAACGTCATCAGGTCTTGGAACTCTTCCTCTGACGT
AATTACCGTGCCTCCTTCACGCTGAAGAGCGGCACCGGCGAGTCGGTCTGCACTTTGGTTCCAGTTTCGCTTCATATGAAGGAAATCGTGACTTGGCCAC
GATCTCAAGCGTTCCATAGCATGTTGGCGTAGTAATGTTAACCCAGGTGCCTTGCACTCGATCTCGCCTCGCATCTGTCGGATGACCACATTCGAATCTC
CGCAGAAAATTAGCCGTCCCTTGGCCAGGTTGGCCAGAAGATCGAAGCATAGGAGCAAACCATGATATTCCGCCTCGTTGAACGTCAAATCGCCCTTGTA
CTGCGACGCAGCTGAAGTCACTTTCCATTCGGGTAAGCTCCACACAATGGCGCCATAcgctcctccacctcgctTTACTCGAGCTGATCCATCAAAGCTG
ACCACTAGCAACTTTTCATCCGCCCCCACGGNCTCGTCCTCACCTTTGTCGCacttgacgatctccaggGTCCAgctcgacagcaacacggcCCAGAGAT
CGAGTCGTCCTTGCAATCCTGATGAGTGCACAAGCCATGTCAACGTGGAGTGCCGAGCCAGCACCTTGACCGATCTCGTCACTAGATGCGTGTAGCAGAC
ATCCAAAATCcggagcagcgcgagaactTCCTTACCGACGATTCCGTAGTTGATCTCGCNTCAGTGCTGTGAAGGCTGTGACAGCTCGACTCCACTTTCC
ATTGTCATCTGTGGGTTGATCTTCGCCGTCCTTGGCTTGCCCAGACGCCGGGCCCAGTTTCGATCTTCGCGCCATCTCATAGAAATCAGCCTCTCGAAGC
TCGTACAGGACCGACGCGTAGATCGCGAAGTCCTCTGTAATAGTTGAGACTACCCAAAAATGACTGTATCGATCTTAGCGTGGTTGGAAATGGCAGACCG
GTCAGTGACAGCAGGTCCTTCTGGTGAGCTTCCAGTCCGTCCGCGGACACCCGATGGCCCAGGTAGTCAACCTTGCGTAGACCCCAGAAGCTCTTGGCAA
CACTGCTCGATAGGTTCCACTCATCACAGGCATCTAGCAGCTTATCCACCTTTTCACACAACGTATCCCACGAATCTGCCGTCACGAGGATGTCGTCAAT
ATAAGATCGATGACCTAGCACCGACG