Description :
From Genome Similarity Track
Location :
Scaffold_127:10017- 11778
Transcript NameFunction/comments
Phyke_g7731hypothetical protein
Phyke_g7732hypothetical protein

Sequence
1761 bases(100 bases per row)
ACCTAACTCACTTCTCCGTCTCGCCATCGTGCAGCTGTGTGTTGTTGGTCAGCGCTCCGCCAATCTATTGAGCGACGGTAGCAACCATATTCCACCATCT
ATCACTCCAATTCTTCAAGTCCACACTAATaacaaaacaacaaattATTTACCACATCACGCATCCCTTCCATCAGCGCCTCTCCATTCCTGTCCAGTGG
GATCTTCTCAATGTTATGTTCAATATCATGCTACAAGATTCATCATCAGATACACAAAGCGTCTCCCCTCAGTGTCTTCTTGTATGCCCCACACAACAGA
CTCAGTCTCAATCTCAATACTTGTGGTTTACCTACATACCTGTACATTGCCAGCCATATCGGCAGACTCCAGAGCTATGACAGAGCAGGGCATTCGAGGG
AACTCGACGTCAAAGTTAATGGACACCATTGTGTTGCGTCCTCCGTCCACCATCATCTTGTCCACTGTATCGGTCGCGAAATAATAGCTGAGCTCGGAGA
CGAGTAGTAACGAGATACAGCAAAAGGCCACGAGAGAAACTAGaaagcaaaacaaaaagagAGGAAGGTTCATGAGTAGAGCGATGGTAGGATACGATAG
ATAGATAGAGGACTGCAATACGCACATAGACCGCCTTGCAGCGTGCGGACCTTGAATTCCTCGATAGTCTTGGGGTAGGCGTCTAACCCCTTGAGCTTGG
ACACCCACGACGCGCTGGAGCTCGCCATGTCGCTTCGCTGCTCTCTGACTCTTGTGTCTGATCCCAAAAAGTGGTGCCACGAAGCATAATACTACTGTGA
ATAATTTGTTAAGTACGAATGAGGTATGGATGGTGTGGCAATGAGACTCGGGGGAAACATACATTCAGACATCGCGCGCATTCACTGTTGGTGCACATGC
ATCCGGATGGTTTGCAGAAGCGACGAGATTCACACTAGTGGGGTAAATTTTTTCAACCATTCACATAGCCTCGCCATTCATACATCTAACACATACTGAC
AAACCCGCTAGATTAATAGGCACTGACAATCAGCAGTTTCCACATGTTTACGCCGAAATGCTAAGAATGGTTGGTGCACTTATGCATTTAGCACGATTAT
TTTTTAAACTGCCTCCTGCTGACCTGCCATTGACCGCCCGCTCCTCTATCGCCTTCTGCAGTAGCCAAACGCTATGCCTGGTACCATTCCAGTTGAGAAT
CATGCGAActcgccaagcagcagcaaaacatCGTCACATGGGAGCCGTGGAATCAAGAAACTTCGCGCTACAGCCATCGCACTCCACAGCCTCGACGGAC
ATATTCACTTGGAATTCCCAGCAGAAGAGGCCATCGAGTTGGAGACGCCCCGACCCGCTGCTGTAAGCCAAACATCGCTTGAGTCGCCCAGACAATTTCA
AGATTCGGCCCATGAGGCCGAGAGTGAAATTGAAGTACTCGACTTGGTGCCTCCGCTGATGAACATCTGCATTATGATCGTGGGCACACGCGGCGACGTC
CAACCGTTCTTGGCTATTGCGCACCGACTGCAACAAGACGGTCATCGTGTACGCTTGGCCACACATGCCGTTTACCGAGAATTCGTCATGAGCCACGGCG
TCGAGTTTTATCCCCTGGGCGGTGACCCCAAAGAGCTGGCAGCCTACATGGTCAAGACGGGTGGCCACCTCATCCCCACCAAGATCGAAACGCTAACCAA
GGATGTGCCACGCAATCGAGAAATGATCAACGAGATCGTGCAGTCCACGTGGCCGGCCGTG