Description :
From Genome Similarity Track
Location :
Scaffold_1:1001679- 1003695
Transcript NameFunction/comments
g309.t1hypothetical protein
g310.t1RAW39604.1 hypothetical protein PC110_g4147 [Phytophthora cactorum

Sequence
2016 bases(100 bases per row)
CGCGAGAGCTCGACGGTATTGAGGCATTCCGCTGTCCGCGCTGCTCGCGTCGACAGAACCTTTACTATCTCGACAAGAAGCTGTTGCGTCGCGAGTGTAT
GGGCCGACGACCAACGCTCGCAAGAGTGGAGAGTTTCCTGAACCAGATGCAGACCCAGCTAGTGGCCTGTCCTCCCGGTGCTCACGAGTTGCTCGCTTAC
ATCCACGCAGTGAAGGGTGTCGAGAGCGATGTCAACGCATTCGTCCACAACTTCGCGTTGCAAGAGTTCTCGCCAGCAGTTTATGCCACGCCAGACTACG
CCAAGACTCAGGAAGCCGCCGTCTTGCGGTTGATGGAGCGCGTGACAAACCTGGAGGTGGGTCTGGAGACAGCACAGACTCAGCTGGGGGCCATGCACTG
GTGCTTGCGAGCGTGCCATCTCGTACTCGGCCCGCATACCCAAGCCCCGCGGTACTCGCATTTGGCAGCCCTGCTGCAGGACGTAAGAAGTCAAGAGCCT
GGCTTTGTGTTTCCTCGGGAGGAGTATCGGCTCATGCAGCTGACGATCGCAGAGCGCGTGAGCAAAGCTGCACAATGGCTACGAGCAACGAAGACACTTG
AGGTTGAAGAGTGGAATGTCGAGAAGGCACGTCGACTGCAGCGCGAGTCCGAGGAGCTGGGCGCTTACCTGGAGCTGCCAGCGACGGAACTGCAGCTTGT
TCAGGGCATCGTAGCTAGTCACGAGACCGTTGTATCGACGGGGCCAGGTTCTGACGAAGAAGAGGAGGAAGAAACGTACGCTGAGCAGCCAGAAAGCCCA
AGCACCATTGCCTGGAAGATGCAGCGACGCCGGTAGAGGGTAGTCAGTAGTTAGCGCACATACCAACTTGCACAAACACAAATGTTCTATAACCCACACA
CAAATGCAAACGCTCGTTGGTGAATGAAAGCACACCTTGAAGGAGACGCCTACGCGCTCGTGGGCGGTGGCGTCGTGCTTTGCTTCTGCTTGAACTCCGC
CCAAAGCGCTGGTGGGAATTGTTCCAAAACCCGTTCGCGCATGTGAGTCTGCGTCTCGGCGTGGATCTCACGGAACTCTTTCTCTCCGTGGTCAGCCTCC
GTCAACACGCGCGGCAGAAGCGCGTCTCCATCCTTTGAGCTCTCATCGTCGGACGACACGAAACGTACTTCCTCGTCGGTCATTTCCTGGTGGATTGCCA
CCTCCACATCAGCCTGCAACTCCGTGAAAATCTACAACAAAACGGCACGAAGGTCCCAAGTAAGACACTGCAAAAACTACTACTTCAATCGAAGCGAATC
ATACCTCCCATTTGGGGAAGTTCTTGACCACCTACGCGAGCAGCAAAACGAGGAGAAAGCGAGAATGTCAGCCCTTGCCTCTAGCAGAATAAAAGCAGTT
GGTACACGTCTGTACTTACAGAGAAGAAGGTGTGCACAGGTGGATTCCGGTATTCGCGGGTAGTAGGCAAGTTGAAGCTGAAGGGTTTGTCCGAAGCGTA
GAAGACGATATTGGCGGCATCCGGCTCGTCCTCCTCCTCCATCTCACGGAAGCACTTGACGTGCTTGAACACGCTCTGCAACGTGCGGTAAATGGATTTT
GGCGCCACCGCACGCGGATCTTGCATGTACCCGACAAAGTTCATGACTAGAACACCGTCGGCCGTAAGCCAGTTGTCTCGAACGTGCATCATTTCCTCTC
GGACAAAGAATGCAAAGGGGTTCCAGCCTGTGTACACGTCCACAATGAACAGGTCGTACGGGTGCTCCTGCTCCGTCTGAACGCCCAAATCCGCCGGTTT
GCTAGCCAAAAACTGGAGTCCGTCCATCACGAAAGTGCGTCCATTCGGGCACGTCTCCTCTTCAATCTCCTCCTCATCCTTGGGCGGGCACCGTTCATAC
TGGAAATAGTCCGCGGCCTGGGTCACCACAGCATCACTGATCTCCACCACATCTAGTACCAAACACAGTAAATAAGTAGTCTACATGGCAATTTTGGGGC
TACATTTTGACGAATC