Description :
From Genome Similarity Track
Location :
Scaffold_415:10016- 12987
Transcript NameFunction/comments
Phyta_totarag8087hypothetical protein

Sequence
2971 bases(100 bases per row)
TCTGTTGTCGTCTATTGCAATTTTCAGACTAGAGCCTTAGGAGTTCACAGTCCACAGCCATGCCGGCCTCCAAGAAGCGCATCCAGAACCGCGGCACGCT
CAATGTGggcacgcagcaagtgccGGCAGCACTGAAAGACTGGGTGCATATCTGGCATGGCGTCAAGGTGAATAACGGATCGGTGGATACGTCTATCTTC
CACGCGGGCTCACGCACCGAGGAGATGCCGTTCTGGAAGCAATTCATCCGGCTGCCGTCCAATTCGCTGTTTCCGAGGGTGTTTACAAGCTCCAATCCGA
GAAAACCGTACAAGGATTTTctgtacgtgctgctgaatATGCGCTGGCCCATGCTActgacggtgctgctgatcATTTTCATGgtcaacatcttcttctt
tgcgGCGGTCACGTGCTTTATCTGTGGAGAGCCGACCAACTTTTTCGAGGCGTTCGACTTGAGTTATCAGACGTTTACGACGATTGGGTTCGGTGTCGTG
TACCCCACGCACACGTGTGGGAATGTGAGCATGTCTGTGGAGTCGTTTGCGTCCATGATGGTCGTGTCGGCTGTTACAGGTCTCGTGTTTGCCAAGTTTG
CCAAGCCGCAGGCTAAGGTGGCTTTCAGCAAGGTCTGTGTTGTGCAGCCCTACGGCAAAAAATACCTAGCACTGGTGGTGCGAGTAGCAAATGCCACACA
GTCGCGAGATGTGACGCACGACGTGATCATGGAGGCTGTATTCAAGGTCAATTTGTTGCGTGTTGAGCACAAGACGAAGCACATTCGTGCTCACGACGAT
GAAGTCACGCTGAAGCGGAGACTTTCTCGGCCAGCTAATTATGCGAtgcaagatgctgaagacaCTGTGGACGACCCCGCTTGTTCAACGAAAGTGCTCA
CGTCCTACAACCTCAAGCTACTGCAGAATAACTTCATCACATTCCGCATGGGTGTGGCCGTCGTGCATCTGATTGATGAGAGCAGTCCGCTGTTCGGGAT
GTCGAAGAACGATATTGCCCAGTCTGATATGCTCGTGGAGGTCGCAATGTCAGGCGTCGACTCCACGCTGCAGGACACCGTTTCCGAGCGGTACATTTAC
ACGGCAGCAAATCTGATGTGGGGGTATCGTTTTGCCGAGTTGCTAGAGTTCAACGAGCGAAATGCCGAGGTTATCATGAACTTCGCGAAACTAAGCACGG
TGGAGTCCGTCCCAATCGATGATGCCCGTTATCTCAAGCCTGTTCTCTCTAACGGTGTATCTCGCGACAGCCACGATAGTGAAGGTAACGGATGCACACA
CAATGTGGCCCGCCGGCGCTCACATCGGAAGTCAAGAGTATCTCACCACCAAGAGGACAGCCATCCCTATCATGATGAAGCCATCCATGAAGTTCCATCG
GAGTATTCAGAACCTTTCATGCTGAGCTCGAGGTCAGGATCTTGGGACGGACAGTCATCTGCTTCGGACAATTCTACACCCGCTCAACCTCACCCCCCTG
TTTCGATCTCGAAGAAACCTGGACCTAAAAAGTTTGGTATGGGACTTGAGCCGCTTTTTGAGCCATTGCTACAGCAGCCTTTTGGAACACAGCGAATACC
GAAAGCTGCGTCTGCCGAAACTCGAGCTGCTCAGAGAGGAGGATTGCGAGTCTGGAGAGAAAAAGATCAGACTAATCTGGAGGATGGACGAGGCCGGCAT
AGCGGACAGCAGTTGACAGCAAGTGACGGACCAAAGGTTCGTACCCGCGATGGTAGTGGGGCTGCGCGTAACAGCGAAGACGGCCGGAGCTCCTTTGAGG
GTCCCGATGGTCTCCGAGCGAAGAACCTGCTTCAAAGAGAAATGGCGGGATCCGCGATGATCGAGgacgacaccagcacaatTTTACAGGAGGAAGGACA
CAAAGACGAATTTGTCGATATTAATGATATCGGCTATATCGACGATATTGTTGATGATGACTACGAGGAGGGCGGCGGGGAAGATGATGCTACtcggcag
cgccagcgtgcACAGACGACGATGTCCGCTGTGTCAATTGAAGTAGAGGACACGCCTCGCTTCTTGCGCATTTTGCCCGTCCACATCCCCAAGTCGTTCA
GCTTTATGCGGCTTTACCAGAGTGCTCTTCACGTACGCTGGCCAAAAATCATTGTCGTGTTTGTGCTGTCGTTCCTAGTCATCAACTTCACCTTTGGACT
GCTGTACTGGTTTGACGCAAACCACATTTCAGTTTATAGCGACGTTGCCGTATCGAAGTATGAGCTGGCGTTCTACATGAGTGTCCATACGCTGGCCACC
ATCGGCTACGGGTCTATTGCGCCGATGCCCGACTCCGTCTACATGAACGTTGTCGTCTTTATCGAGTCCATGGTTGGAATCATAGCTGTGACGATCATTA
CTGGCATCGCTTGGTCCAAGTTTGCTCGACCGCGAGCACAcatccacttctcgtcgCAGATGACTATCTCGACCATCTACGGACACCGTTGCCTCGTTTT
CCGTGCCGCTAATACGCGGCACTCCGGCGAAGTGCACGAGAACTTCTTCCGCATCGGCGTGATCCTCACAAACCGGCGCACAGGGCTACGTCAGATGTAC
GACGTGCCGCTAGTGACAGCCGAGTGGCCGTCCATTAAACTACCGGCGACGCTCATCCACGCCATCAACGAGAACTCGCCGTTCTACAAGTTTCACTCCA
TGGAGGACCTATCCCAATCACGAGTCGCAGTCATCGCGTTGCTCACGGGCCTCGATACAACCTTTTCGGAGAACGTGTACGCACGCAAGATGTACTTCTG
GGATGATTTTGCTTACGACATGCGCTTTGATGACTTCGCTGTCATTGAACGTGACCGCGTTATAGTAGACTACGAGCGCTTCGATCTCCTCATACCTGAG
GACCGAGACGAACAGGTCGTCACCACACCAGTGCTCTCCTCGGTGAGATCTTCAACTGCTGACGTAGTGTA