Description :
From Genome Similarity Track
Location :
Scaffold_15:100158- 122362
Transcript NameFunction/comments
Phyta_totarag975hypothetical protein
Phyta_totarag976hypothetical protein
Phyta_totarag977hypothetical protein PHYSODRAFT_259487
Phyta_totarag978hypothetical protein PHYSODRAFT_313225
Phyta_totarag979myosin-like protein
Phyta_totarag980hypothetical protein PHYSODRAFT_542020
Phyta_totarag981hypothetical protein PHYSODRAFT_313255
Phyta_totarag982hypothetical protein

Sequence
22204 bases(100 bases per row)
CTATGATTGCTGCACTTTCCTGCCCAGCCTGTTCCTACCACGCGACTTACTCACTAGCTCGTCGCTGCTTACTGCATTCCTCGCAGGCACCTAACTGCCC
ACCGAGTAgttcagcagcgacggatCAATATTTTGGCCCTTGGAGCGGCGCTTGCCTCGCTTATTAGACGAACCCGTCTCGGATGCCCGCTGTTGGGCGT
CCTGGTGCCCAGGTGACTTCTTACCGCTGTGTTGCGTCTTTTTCCGCTGGATGAACTCCGTGGCGAACGCCGACACACGAGGTGTCGAGCCCAAATACGC
CGCAAGATACTCGCGGACTTCGCCGGGGTCCTCTACCGACGCACAGTATTCAAGCAACGTCACGTTGGCATTGCTGTCAATagtcttcaactgcttcaga
GCCCACGTCATAAACTCTGACGACACATTGTTTGAGCCAAACGCATTTGAGCTGCCCGTCTGAGCACCGATCGATGCAGACTCTTTACCAGCCGGCTGGG
CTGCTCCAAAGTTCCAGAACGACGCATCGCTCTCGGTCTTAGATGGGGATGGCTTTGCTGCACCGTTGGTGGCACGGATCTGCTGGCGGCTCTTCAGTAC
GGACGCAGGAACAGGACCCAATACTGATAGAGATGGCTTGGGgattgctgcagcagtgacCTTGTTGCCTGCCACGACGTTCATCCAGTGCGAGCTGGTA
GGCGCATTCTCGTTGGCTCTAGCCCGTTCCTGCGCCAagcgctcttcttcggccaAAATATCACGCATCGActtcgagttgctgctctttGTAACAGCGA
CGGGTGCACCCCACGGACTTGCCACAGATGTagaaggagctggtgtcgGTGCCGGCGTAGGCGTAGGCTTAGTTACCGGAGCCGGTGGTGTGGGGGCTGA
GGAAGCGCTCGGTGCTACAGCCGTTGAATCCACGCCCAGCATCATCTTTAACTGTGCCCCCATTTGCGCGAGATTCGCGGTGTTGCCCTTGTCATCGCTC
ATCTTGTTAAGCAGTTCTCGTTGCTCTTCCTGTTGGATGTCCTTGAGCGACTTGGACTTGTTTGATGCTGTAGCAGACGCCGCTCCGGTAGCCCACGCGT
GAGTCTCACTCTTGGTGTTTTCTGCATTATTTCCGTTCTTTTTAGATGggttcgtcttcttctccttgactTCGCCAGACTTGATATTCTTCTTGGTCGA
TTTGACATGTGAGGCGTCCTTGGGCTGTTCCTGCTCTGAGCCAGCCTGGTCACCGTTTATGCGAGCTtcgtgagcagcacgacgctTTTCTTCATTCTGG
ATATCGTGAAGTGTTGGTGACGGTTGCTCCGGTGACTTCGGTCTAGCGCCCCAAGCATCAACCACGGGGACAGCAGTTGGACTTTTCGGTGCAGGAGGCT
GAGTAGATTCCGGTGCCATTGGGCTTGTAGGTCGCGCTGATTGCAAGCCACCTAGCGTGCTAGTGGCATTTTCTAAACCAGACATTTCCGGGGCAGCGTT
CGGCCAAAATGCTTGGTCGCGCCTCTGGACTTCGCCATTTAAGAACATTGAGTCTTGACCAAGGGGTTGGGTGTTCTGCAGGCTCAGTTGGTGTTGCGTG
CGGTAATCGGACTGGAATTGAATCTGCATGCCGTCCGTTCTGAACTGGTCGTTCGGTGCGATATTGGTATCTTGGTTCCCTCCAAATATGCCCAGCGCGC
TCATAATACCTTCACGCTGGCTACGCTGCCACGaactttgctgctgcaggagcatttgttgttgttgttgctgctgccgctgctgctcttgttgatgttg
cagcatatgctgctgctgatacaactgcgtttgctgctgttgacgtgCTATTTCAAGGCGTTGCATCTCCATGCGaatcttctcttcttggttcAGCTGA
AGCAtgcgttgttgttgctgctgctgctgaagctgcatcatttgctgttgttgctgacgctgctgctcatgctgcagTTCCAAtaaacgctgctgctcac
tttGGCGAGGGTCCACATGCATTCCTCCAATACCACTCATACGTGTCGGCAGGGCGGCGAAAGGTACTTGCCCGTGGACGAACTGACTCGCCAGGGCCGT
AAAAATGCCTTCCCGGCCAAAGCGAATCGGGAGGTGAGGCTTGAAGTAGCCTGCCTCAAACCACTCACGCATCTCAGCAGTTTTGAACGGCCCCTGCTGC
AATCCCTGCGGGTCCAGGTAAAACCATTCGTCCTCCACTTTCAggcgcagcgacgacatccCTGCGAAACCCTCGTCAGCTGGCATTTGAGACAACGAGA
AGCTACTCTTCTCTTCAAGAACAACTTGCTCGCCAGCAGGTTCCAGCGCATCGAAAAGGTGGCTGCCGCTTGACTGACGGCCCAGCAAGTTCGCCGTGTG
ATCTTCCAACGGACCGTTAGCACTGTTAGTGTTGTGTTGCTCCTCGGGAGAAGGATCATCCCACTGCGCTTCTTCATTATCACTGTCGTCAAattgtcca
gcagctgcagcatcctcAAGTTTCTGGTCGAAGGCATCCAAATCGTCCTTAATCTCGTCCTATCAAAGCATTACACGAAATCAGTTTCCGTGGGGACACA
GCAGTTAGCAGTTTCTGCTGTGACTAGCCTTACCGGATCGGCCTTCGGACCCTGGAGCTCCTCTCGCATCGCATCCATTTCTCGTCGGAATTTCTCCGCT
GCCTTCGCCATACTTGACAGGTCCTGAAATCGTGcaaaccacaacaaccagCCCACATTAGCCGCCTACTCACCTAACCGTCACCTCCTTGCACCAAGCG
ACGCACCATTTCATTGCTATCCGCGCCTGGCTCCAGTACATCGTCCCAGACGTCGTCTCCGCGAGATCCCTCCGTGACCTTGGCGCCACGCTCCCACATC
GAGTCTCTCTCATTGTGTCGGTGGTGTTCGtctctctgctgcttggcaggACCCTCCGTCTCTTCCCCACGTGATCCCCGTTCCTGGTGTCCACGTGTCC
CCTGCTGTCCCCCGGGAGGCGCATtgccacgtccacgtccgcGTCCGCGATTGCGGTTGAGCGACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGTAG
CGTGCTCACTGGCGGCAGACTGTGCTCCGACGCCACCGTCGTCTCCGGCGGGAACGTGGGCAGCTCGGTGGTTGTGAaatgcagcgccagcagctcctcc
ttggagTAGCGCAGTACTTTGCTCTTGCGTCGCTCGCCTCGGTGGTCgtcgcctgctcctcctcctgtgGCCGCGTCTTTAAAGGACGTGGGGCCGCCGC
CAGACgtcgcggacgacgacgacacgaagCCCTCGCCGTCCTTGGACCATTGCGGGCGATAGGCCGATCCCTCGGACTCGGTACGGCCTCGGCCCTTCAT
GGCGAACATTGTGCGCGGTCGCAGCGAGatgttgctactgctgttggtgctggcggcGGCTCCGTTGGCGCTGGTGGGGGCCCCCGCGGGGGGATTCTTG
GTCAGGTCGGGCACAgcctgcgtctgctgctgctgtttcttgcGGTGCTTGGTGGTCTTGGtgacgaagtcgtcgtcattACTGGGGCTGCTACTCATGG
CTGCGGCCGTCGCTCGGTGGCTCTCGCTTTTGTTGGTTGCTCCTCTTTCTTTGCGTGGGGGGCCTGCTAAGCGGTGCTGCCAATTTcgactaagtacgaa
tttTACATTGCTATTGCATAGCACCCATTGGGCTATGTTTTGTGTCGGACTAATAGAAACCGAGTTAGAAACAATATTCGCGGACGTCGATGAGCGCGAG
CGGTGCCGGGCTGCGTAATTGGCGGTGCGTTCCTGCCTCCGACTTAATTGCCTGAACCTGTCGCCAATGTGCATGTGTCCTCTGTGTTGCTATTGTCTGA
CTGAAATATCTGTGCGTATTTCGATTGCAGTGGCGAGATTATCAAGTCCAAAGCGGCTCCGTCGGGTGAAGCTGTCGGTGACTGCCCCTCAGCTGACTCC
CAGTCTGCTGTTAGCGCCGTAAATGTATCGTCAAGGGTAgagaacaagaaggagcgactgcgGCATCCTCGGAGGGAACGACGTTCggtgcagatgaaga
agatgctgtggAAGGACGAGTTCGGTCGAGACGTGGAGGTCCCCGTCGAGGAGAAGCGTCACAAGAGGTCGAAACGTGAGACGGAGAAAgacgtgaagaa
ggagcacaagcacaaacatAAACGCAAGAAACACAAACACGGGCGGGACAAGAGCAGCGGCAGATCGAGGTCCCTGAGTCCTCAAGGCCGCCTTGTTGGC
actcctccgccgccagACCCATTTCGTCCGCAGGTACTGTCTGTAGACTTGGAGTATGTTGATATCGTGCACTAGAAAGGCTGAATGTAATTGACATGGT
ATGATGTCAGCTGGGCGAAGATCGAGGCAATCGCCCGCAGCGGAACCAGCATGGTAGGAatcgaagtcgaagtcgcagcAGGAGCCGTTCACGCGGTCAC
ACTCAAAGTCGAAGCCGCAGAGACACAAGTCCACGCAGTAGTAGACACCATCGTCGGAACTCCCCCCGGAGTCGTAGCAGAAGTCGAGGCAGAAACCGAA
GTCGAAGCCCACCATCTTCTCGGACTCATCGCCGGCGCTCATCGGCCTCAGTGGAGCAGAAGTGGACTCATAGTGCCTTCGATGATCGCAGCCCAAGTCC
ACCGCGAGAGCTTGATCCATTTTATCGACCGGAACCTGAGGCGTGGGTGTCGCGAGCAGGCGGTGTGTACTTGCCTCGCAAATAGCATCGCTCGGAAGCG
TCGTATCGCCTGGAGTCGTTCACCGGTAACACAAGACACCAAATGAGCACGCTCCTCCGTGACTGGGATGAAGGTGCACAAGCTTAACCATTAGCTTTTG
CTTGACTTGGGATCATACGAATGGCTTTCGATTTGTCTGCTGGCCTAACGACTTAGCTACCTTATTGCTATTAATTCTGTTCCTTCAGGCtcgaagagca
agcgcaagaagctcctCGACTGGATCTACAGCCGCTTTGACCCGACACAAGACGGAGGTGGGCTACTCGAGAACGAGTGCGGGGCAGACATTGCTCTGTT
CCTACCACGTCTCCTGTCGTGGATGCAGAAAACAACGGCAAGCGCCGTTTACAGCATCAACGAgacctgcagcgccacggcaAAGCCAGGAAAAGTCAAA
TGTTTTGCGCTTGCCGAGCAAGTGGCTTGTCTTCAAGTATTTTTCGGATCGGTGAATGCATACGCATACTTTCAAGAGTTCCAGCATGCAGATGGTCTTC
AGTTGGTGTTGAAGATCGTGGCCATACACAGAAATGATCCCCAGACTCAAAAACCGCTGGTGTCAGCCGCCGCCCGAGAAACCTTATTTCGCATCATCCT
GCGGGTCTCCAAGATGAGTCGACAATGCAAAGAGGAGATCAGTTGTCTTGGCGGCGAGCTAGCTGTGATTCACGGAGTCCTGGCTAGTGGCTACAGCGAC
GATTGGAAAGCGGAGTCTCGTGTGTGGACTCTTTGTCGGGAAGTGCTTATTGAGCAACTCGTAGGCAGCCCCAACAGTCTTGATCGAGCTCACGAGGCGA
TTGTATTCATGCTGAGGCACTCCGAAACGCGTCTTCAACTCTTTGGAGCACAGGTAAAATGAGCGCTTGCTGAGCTCTTGCATCTATTTTCCATGCAGCG
AACTAACCATACTGGACATCCATCTTTCCATGCGTTGGTGCTACATGTAGGTTCTCCGAGAGTTAGTCACAGACAGCTCATTCTCCTTTGATCCGGAGTA
TCGACGGCGGAAAGAGCATGACCTTGTGCCTCTCTGCCTGTCCCTCCTCAATTCGACTGATGTCTATCTTCAGCACGAAagccttgagcttctccacgct
ctCTTGCAGTCGAAACATTTACAGGTTTGCATGTATTTTGACGAATGTATTGTGTCGATGAAAACTTGCTGATCGAAGTACAGTAGGATCTAATTTGCGA
GAAACTTGTTCGCTTGGTCGGGGACAGCGCCAAGGCACTGGACGCGTACGCTTCTACCGCAtaactgtacatgtagtttcCTGCTCACTAACCAATCTCT
CACTAACGAACATGATCTACTCAAATTCCAGCAAAGTTGAAGAACGATTTGCCTCGATCGAAGATACTACAGAGCATGAAACCTATGCTCATCTCCGGTC
AGGATTTACCAATGCATCTCAAGCCGTCAACACTCTGATGCACTCGAATCGAAACCTGTTGCCAATTCTGGTACGTATGTCTGCGCTCGAATGACCAATA
TCTAGCTCTTTATCTCTGATTGCAGAAGTGCATGAACAGGTCGATCGGTATGGTCTGCTTACTCCTCTGGCGTTCGTGCTCGTTATTGAGCGGCCTCACT
CCCTAAAATGgcacgccgccgccatcaGCACCCGATACATTTTTTCGCACCACTACCGGGTAATAAGCATCTGTGCCCGCTTTGGACACGCAGACATTCA
AACTGATCGATGGGGATGCTATGTACGTTGATGCTAGGGAGCAGCTGCATGTATCGCTGAGCTTTTTGAGGTTCCAATGGAGGAGCTTCTTGAATGGAAA
GACAaacgaggagatgaaggcgagaTGCTCGCTCAGTTTCTTGTGGGCGATGAGGCTCGCCAGGGCCACCTTGCACTCCAATTTTATCAGCGTGGGTGGT
TCCGTCCGCTGTCCCCGAGAAAGCAGTCCGAGCAGGCTGGCGCAGATCACGTCCTTAACGACATCGAGGGCAGTGTCGAGACGGCGGCACGAGACTACGT
TCCCGAGGTAATGACTGATATCTATCCTCGTTTCAATCCACCCAGACTGCTCACTGTTTATTTTCTTCTTTTGGCggcagctgcaagtgcaaacACGAGT
AGGCGAGAACTTcgacgagacggaggagatggaAATtctggaagcgcagcgcgaGCACCACCTGCGCATCCAGCTGCAAATGCATTTCGCGCAGTTCCGC
CATGTCTCAGCAACCGCAGCCGcaaccaacagcaacaagtagACACAGAACTAGCACTCTACGTGAAATTAATACCACGAGGCTGCTGTGGCAACGTCCA
ACAGCccctttcttcttcaagccaAGTCTCCCAAGCTCTAGCTCTCCTCGGGCGTGTAGTGGTCCTCGAGGAAGCGCgagagcgtctgcagctgctccga
CACGACCTTGACTTTCTCGCGGCAgatctccacgtccttctcggcgccGTACGTGCTGCGCGCAAAGGTGCGATAGTCCGAGACCAGGTGGATGTGGTTG
GCCAGCTCGGTGTGGATCTCCtggaccagctgcaggaactcggtGCACGCCGAGTTGAAGGCCAGCGACGAGTTCTCCTCGGATGACACGCGCGGCGCCA
TGAGGGACATGGCGGTGGCCGCCGTGCGCAGCGCCGTCACCAGTTTCTAAAGCGGCAGGGAAAAGGTCAGACGCAAAAGTCTTTTATGCGCACAAGACAG
AGAGTTCGCGCAGAAATTTGACTGGGTGGTAAGCAAACGCACCTTTTCGACGGCATCGAGCGCCTGCAGTACCACCACGTGCCGAGAGCTGGACCACGGG
TCGCTCACCTCGGAGAAGTGCACGCGACTGTCGCCTTCGCCCTCCATGCTCGGCCGTTGGCACAATGCGATGCATCGGTTTGGACGGGGTCTATCTCCCT
TCTATAACCGATATAGCTACATAGGCCGAGTTTGACAGAACGGAGCTCGACTAAAAATCGAGACCTGAGATCAATGGCTGATCTGCCGctcatcttcagc
ttctctATGCCATTGCTCTTTTGTGTGTAAGCATGCTTGCAGCGTTGACTCACGTGGgactccaccaccaccaccatccGCTGTCGAGGCAGCTTCTGGT
GCAATGTCAATCAggtgtcttcgtcgctccCATCGTCGCTGGCGATTGCCATCTTTTCGTCCAGGCTCGACAGAAACCACTTAGAGTGAGTGACGCCACT
GCAATACTTGTATTATAGTGGCGCGTTTTGCTCTCGACTAAGCCGTTGCCGTAGCGTTACTGAGCTTGGTACTGCAAAGTGGTCTggttgcaacttgcaa
gcATCGTTACGGTGGtggtctacatgtacatgtactcgagTGGCAGCGGCACGACGACTTGCGAGTGACTCGTTGTTTGCTCTGGTTTCGATGCGTCGCT
CGCGTCGTTTCGTGCAGCAAGTTGCGATTGTGGCCTGTTTGCATAGCGCGGCCACTTCATAGCTCTAAAGGTGGGCGTGCTTTCTAAAACATGGCATTCG
ATGTTCGTTCAGCCAGTATGCGGCGCTCAACGAGTAAACGTTTCTTCGAGAGGTTCAGGAAAGGGACTCGACAATGGTTCGCGGTAGTCCGATCACAGGG
TCACTCGCCACTTCAGATAGGTCGACGGATCTCAACAATATAGCGGTTTGTTCAGGAGAGAGGTGTGACCTTCACAGACGCAGCGACGAACGGTCAGACC
TGACACAGCTGAATGGCTATAAGCTGGTTAATGAGCAGCTTAATACGATGGCACCAGTGGGTATGACTTCCCCGCTTACTTCGAAGCGTATTGGCGCCAC
TTACTTTTTCAATAAAAATGGCAAACCACAAATTGCCCAGGTCCACCCTACCCTTCCTGCCCTATCCGCAGTCGGTCCTTTCCCATTGCTATTCGCACGT
CATTTtcatacaaacatcaagtTAAATCCTACCGTGAAACTCCATTTTGCCATTCTTGTTCCTATCCCACAAAAGTGAAAGTTCTCGGCACCGCAACTCG
AACATGGCATCGGCCGCGGAGCTTCGCGCACAGAACGAGCGCATGGCGCGTGAGatccacgcgctgctcagCTCCAATACGacgctcgagaaggaggtga
tGGAGCTCACATCGGAgcgcgacgagctggagaccaCTGGTAGcaagaaggtgcagacgctgaagcaggagctcgagacggtggacgaggagctcacatc
gctgcgctcgcagTGCCAGTCCATGACGGAAATCATCAAGAACGCGGACgccgagaacgagatcgaggccgaggaggagccAGCGCCGATGCCAGTCAGT
CGCAAACTGTCCACGGCCATTAACCACACAATGCAGCGCGCCAGAGGCATGTCGGTGCCTCGGCAGCGACGGTCGTCGACGGTGGAGATGGTAGCTCACG
GCCTCACCAAGGCAGCGAGCTACATGATCCCACCCACAGGAAAACCGAGCCCCGACGAGCCTCGCCGCCCCAAGATGAACAAGGACAGCCCGCCGATCCT
GTCGTACTCGAAAGGTTCCACCAAGAGTCTGCTGTTCTCGACACACTCGCACTACGGCAACTTCCGGCGGCACAGTGGGCCCTATCGCAAGAACCGCGAC
CCTGTCATGGTGCTCTAAGAAGGTGCTTCAGCACCGACCTACTCAAGGAAGCGTCGAGGGAAGCCACCTGCTCTATTCATTATTTaacgccaacaacaac
agtcATGTTCAGCTAAAGCTAGCTACATCCGTCCAGTCCAGCGTCGATCACGCCCTGGAAGACCACACAGATCGCCAACCACTGGACTTTCGCTGCCCTC
TGCTTTTCTGACAGACAGAAAAGCAAggggaggagaagaagaccagGTCAACGACCCAGAAGAAAGTCTTTCGAGGTGGTACACTATGTATGTCCATCGA
ATCTACTACTGTAtgtagtattaatacatgtagtcccCGTTCAATCGCACCGTGTTGCATCCTGTACTTGCGATGTTTGTGCGCTGAGCATGGATGATAT
GTTTATTATGGATCGCAACTACTACTAAAGGAGGGATAACACGCATGTTCGAAGCGCCGAGGCGATAACACGCTAGCTGCAGGttcgtggtgtcgtcgtg
gCGTCTCTTCGTCTACTTACAGCGCGTTAGCCGACTTCTGGCGCGCCAGCTTCTGTGCCTTGAGCGAGGCCAGGGTGGGGCGCTCGAACTGGGACTTGCC
AAGCTTGCGGTTCACATAGTACACGCGACCGGTGGAGCGCGACACCTTGGCCTCCCAACCGACAGGCAGGGATACCTCCGGCAACGCATCCAGGTTGAAC
GACTCACGCACAGGACGATCCGCCGGCTTAGCTGCCGGATTCACCTTTGCACTCTTCGAGGTAACGACCGTCGTCGACGCAACATTGTCGGACGTGTTTG
CGGTCTCATCAGGCTTGCTGTTCGTGCGCTTGCTCCGAGAATCGTACATGCCCTTCACGACCGACATGCGGCCCTTCAGACTCGACATGGCACCCGTCAC
GCCCACTTCCACGCTTTTTACGATCGTGTTGcgtgtggtgctgttcgtgggACTGTCCTCACCGTCAACCTCCGAgacgtcgaagccgtcgccgttGTCG
CCCTTCTTGTTAGAGTTCCAGAAGCGAGAGCCCACGCTCATACTCGGCATGCGCGGGAAATGGCCGCGCTCCGACTGACGTGTCTCCGACGAACGACGGT
TAAGGTCGTCCGAGCCAGTAAGAGAGTCCATCAGCACAGTCTCGCggggcttcttctccttcttggagCCCAGCGTGCGGAAgatcgacttcttctgcgt
cGGCTTCTTCTCAGGCACACCGTCCACGTGGAGCTTCGCAAGCTGctccgtcagcttcttgttgtctgcctcgagctgcttgatcttcttgtccttgtca
CGCACAGTGTCCTGCAGCTGACGTACCTTGACGTGGTTGCCAGCCGACGAGAACTCCTTGTCGCTCTTGAATTTCTCGATCTCCACCTTCAAGCCCTTCA
TCGTAACCTTCATTTCCTCATTCTTCTCACGaagcttcttgttctcgtcTGTGAGCGTCTCGATCATGCCACCAGCGTCAGCCATCACCACGCTCGAGGC
AGCAGAAGAGTCCGCCGTCgtcacgctgctgcggcgctgcagctgcgcattccgctcctgctcttcctgcagaGCGGCCTTCAGCTTGTGCAGCTGGTAA
GCCATGTCAGCCTCACGACGCTTCtcttcaagagcagcaagataTTTTGGCCGCTGGATCGTCATGCGAACCACAGCCTGTACACGGATAACCATCGCCC
GCATCTTAACGTAACGGTGGCGCTTGACAAAGCCGCGCACATACCGCTGGATGATGACAGCATAGTGATTGCTCTTGACATCCGCTGCCACCTTCCGGCC
TTGAAGGCCTCGCCAGCGAGCTTGCGCCAAAGTGAGGCCATTCAGGAACGTGTTGTATCTCCGCATAGCAATTACGCATCGGATCACTGACTGCAACTTG
ATGATCGCTTCCAGTTGTCGGAGGTACTTGATACGCTGCGTGAAGCCAACCATGATGTTCTGCACGTACGTGGCCTTGGCGTCCAGAAATTTCTTACGGC
GAtcctcgagctcttcaagcaCACCCAGCTGGAAGTACACCCGGGTCTTACCCATCTGATACTGCATGGGGGACTCCAGTTTCAGTTTGTCCATCAGTAG
CTGGCACTTGTCTGCCGCGGTCTCACCGCCACTCGGCACAAACAGCCAAAACTTGTCCAGAATCTCAGTGTGCTGCAACCTGTTCGGGTATGCTGCGCGC
GAGATACGAATGGCCTCAATCACACCAGCACATCGCAACTGGGACACCACCATGGATTGATCCATGACTGTCGCGCTCTTAATCGGGTTGGGCTTGATGC
AACGCACGTAGTGCACACGGGTGGAGTTAATGGTCGCCATCAGCTCCGTCAGGCTTTCCTTAAACTGGGTGCCGACAGTCGTGATGGACAAAGCACCACC
ACGCTTTCGGCGACCGCCCGGTGCctcagaagcagcagtcTTGGGCTCCGGCTTCGGTTCGAAGAGCTTCGCGATGAACGGCTTGGACGAACCACGCATG
AGCTCGGACAAATCAGGCAGCAACGAATCCTTgtgcttctccaggaagCCCACCGAATCATACATGACAGGAGCGGCATAGTGCTTGATAAGGAATTCGG
TACGCGATGTGCGAGGGAATTCAATAACGTGCGCCATATCGTCCTTGTGAAGGGACGTCACCTTGGACATAAAGGACTCCTCGCTACCCTTGGGTCGCAT
CACCTCTTCGTTCAGTAGCGAAATGATACCCATGCGCGACTCAACCACGGTCAGCACGTCCTGGTTATCAGCGTACTCAATGTGATCCCACACAATACCT
TCTTCCTCGTACTCAATCTGCACGGTCTTGAACACATCCTGAGTGAACTTCTGCTGAAGCTTCTCGTTGGCGTAGTTAATGCAGAACTGCTCGAACGAGT
TGtgcttgaagtgctcgaaACCGAAGATATCGAGCACACCCACGTGGTTTGCCATGTTAGCATCATCCGCAAGGGACTGGTTAATCGTGTCCACCAGCCA
GTCGAACACGTTGGAGTAGATAGCCTTGGCAAGTGCGTCACGGCAGTCCATagccagctccttcttcagcggcACGCTGTACACATCGTTCACGGCGCGC
ATGGTACGCGAACACAATGCAGTCTGAAGCGCCTCCCACGTGACGCCAAGCATCTGAGTAGCAGCATTCGCACCACTGTCGCCTACGGTGATTAGAGACT
TCTCGTCATCTGATGCGTCCGATTGCAGCTGCACCTCACCAAGGTGGAGCACACCGGCCAGCACCTCAAACAgaggctgctggtcatcgcGCGACAGACC
cacaagctccagcgcctcgcgcgtcttgttgaagtgcttctCGTCCGAGAGTCCTTCGATCTTTTGCGCCGTGTTGTCACCCGTGTACACGTAGTGCTTT
GTCgagtcgagctgcagctccgccgcAATGTCGGGGGAGTCTAGCAGCTGGTAGAAGATGTGGTAGTTGCGCTCCGGCGCTTCGTGCTGAATGACAcgcg
tcttctccagcaggtaCGTGCGGCATTTCGCACCAACGAGCGTGCCATTCTTGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTT
GCGCACCGTCTTGGCGTTACCGAAGGACTCGAGCAGAGGGTTCACTTCGATAATCCTCTTGATGGTCGAGTTGTTCATACCACCGGCAATGGTAGCCAGG
TGGTTCATGAGGATCTTGGTGGTCTCCGTCTTACCGGCACCAGACTCGCCACTCACCAGAATGGACTGGTTGCGTTCCGAACGCCGCATGTTGTCGTAGG
CAGCGACCGACGTCGCGTACACGTGCGGGGggagctcctccttgggcTGGTTCAGGTACcgcagatgctgctcctCGGCGTAGAGCTCAGGCAGCCACTT
GTACGGGTTGATGGCGATGCAAATGTCGCCCGTGTACGTGTAGGGAAGCTCGCAGAggaagcgcttcttgatgTTGAACAGGATGGCGGCCTCGTGCAGG
TAGTTGAGCGTGATCATGTCCTCGATGCCCTCGGGTCCCACGTTCTCGTTCTGGTAGGGTAGTGTCTCGAGTTGgtgcacatccagcagcgccttggtct
tcttggaCAGCATATCCACGCAGCGCTCCTCGGTCTCGCCGTCGGGCAGCTCCACCTTGCAGTAGATCTTGCGCGTCTTGCCATCGCCCGAGTTctcgtc
gcgcagcacctccgcCGCGAGCCACACGTGCGTCTCGTCCGGCACGAAGCACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCTTCAGATCTC
TCTCAGCGACGTCTTCTGCCCCTTAAAACTCAGGGGGGAACGGGTGCAAGTGCGCGCGAGGAAAGCGGAATGCGAATGCGGTCGCCTCGTGTCACGAAGG
GAGGATTAGATACCGGTAAATGGAGCCATCTTGCGAGTAGCAACACATTCACTTGAAGTTTGTAAAACCACCCTGATTTGACAACCGTTGGTTTAGACAT
AGCCCGGCCAGCGCAGCTGGCGGAGCAACAGTGGCTAGGATTGACGGATAGCACGCGAGAGGATTTGAGCTACGCTTTCACGTGCAGACTCGTAGCAACA
CGGCCGTCGTGCGATGCAGTAACCACTTGTCGTGCCTCCGTAGGCCGATGTAATTGTGGTGCGTGCCTTCACATGGCTAAGTATCACACAAAAACCTTCT
TCCAGTACGGTAACGATGTGCGGACGAAAGCCTCATTTGTGGCGGTCGTTTTCTGCAACGAACATGATTTACCGCAgactgcttcaacttgttcaaGCAC
ATACTGATTGTTTGAGACTGTTATATAGCATACCGGTAGAAATCGATGACGCACGAGTCAGAGCGATGGTCAAAGGGCGCAATCAATGGCAATCATCGAC
GTCAGCGCAATTCGATAGCCGCGCACTtccaagatggcgtcgatgctgctgctacgtcGGCCGATACTCTCTGCGCGTTCGCAGCGCGTCCTGGGCGCTA
GTCTagcgcgcagcttcagcgcttCTGCCTCAGCGGtcgctcctcctcgtcgcgTGTGCGTAGTCGGCTCCGGCCCTGCGGGCTTCTACGCCACCAAGTA
CCTGCTCAAGGAGCACGCCGGTGCGCGcgtggacatgctggaggcgctgccgACGCCGTTCGGTCTTGTACGCTCCGGCGTGGCGCCCGACCACCCGGAG
GTGAAGAGCGTCATgaacgacttcaacaaggTGGCGGCCGACGAGCGCTTCCGCTTCCTGGGCAACGTGCGCGTGGGCGAGGACGTGACGCtcgccgagc
tgcagcagcactaccacgccgtggtgctggcctacggtgctgctggagaccGTGAGCTGGGCGTCCCGGGCGAGGATCTGCGCGGTGTCATGGCGGCACG
CACGTTCGTGAACTGGTACAACGGCCACCCGGCCTTCCGCGACCTGGAACTGGACttgaagcaggtggagaCGGCGGTCATCGTCGGCCAGGGCAACGTG
GCCGTGGACTGCGCTCGGATTCTTACGAAGAACGTGGATGAGTTGACAACGACTGACATTGCGGCCCATGCGGTGGAGGTGCTACGCAACAgcgccatca
agaaggtTTTCCTGGTGGGACGACGCGGCAGTGCGCAGGCGGCGTTcacgatgaaggagatcCGAGAGCTGACGAAACTGGACGGCGTTGCCTGCATTGT
TGACCCGGAAGACCTAACGCGCAGCATGACTCCCGCATCTGAGCAGGAAATCAAAGAGCAGCGCGCTCGCAAGCGCATGAACGACTTGCTGGGCAAGGCG
GCGGAGCAGTTCGAAAATACTAGCGACGCCAAACGCGTTGTGCAAATCAAGTTTTTGAGCTCGCCAGTGGAAATTATCGCGGACGAGAATGACCCGACTC
AAGTGGGGGCAATTCgtgtggagaagacgaagctggAGGGCGAGCCGAACCAGCAGCGTGCTGTGGGAACTGGAGAGTTTGAGGACATTCCGTGCAACCT
CGTGCTGCGCAGCATCGGCTACAAGTCAATGCCCATCGAGGCAGATGTGCCGTTTGACAACCGTCGTCATGTGGTTTCAAACGACCAAGGACGCGTTGTC
ACTACCTTAAACGGCGGTGAGAAGAAGCCTGTGGTAGGGTTGTTTTGCACCGGGTGGGTGAAGCGTGGCCCCTCTGGCATCATTGGGACCAATATTGTGG
ACGCACGGGAGACGGTAGGGTGCATTGTGGAGGACTTTGCAGCGGGGAACTTCCTTCACAGCGACAATAGCGCCGATGAGGACTTGGGTGGACTGGAGgc
tgtggaggagctcatcaagaagcGTAACCcagacaagcagctcgtTAGATGGGCTGACTATGAGCGTCTCAACTCCGAGGAGAACGACCGCGGCGAACTT
GTCGGGAAGCCGCGCGAGAAGGTCACGTCCGTGACAAAGATGCTCGAGATCGCGAAAAGTGTCAAGTGACGTACTAAAGAACCAAGCAGCTGAGATTCGG
AGCAGGGAGTAGAGGTACACACAAGCCATTTTTAATCCACGACAAAACCTCGAGTGAGACTTTTTAGATCCTTAAGCCATTGCGTTCATTTTGACGAGTA
AGTGCAGCATTTGCGGCTTTCAAGGCTCGAGTCTTCTTGCGCTGGAGTGTCATGCATACAAACCATGGAGAATTGTTTGTCAACCACGAGACTCCAAGCA
AAGTGTACAAATGAAGCGTATCGTACCTCTTCTTCTAGTAGTCGCATTAGACGCCGACACTCTGCTGTGTCTTCAATCCTGTCGTCTGCGTGCTGTTCTC
TCGGCCCAGATCTAGAGTGAAGTGCACCACTACCCGTACTCTCGGACCGTCCTTCGTATACAACTTGCTCATTGTCTTCAGGGGTGAGAGGATCAATAAG
AGATTGATTTACTCGGTCACGTAGAACTGCTGCAAATGTTGGTTTGGTTCTTCGCACTGGCGCTGACACTGGTCGCGATAACTTGATTCGGGCTATCGCT
GATGGTACCGGTATTGGCGCAGCAGAGCGCGGGTGTTGTAAGGGAagtcgtgctgctgccgtcgtcaTCTAAACGCACCACGATTTCACAGTTAGAAGAT
ATTGCTGCTTTTTAACATAAACGTCACATGCATGCATGCTCGTACAACGGCTTTCACGTGCCGAAGCTTCGTTGGGTCCGCCAGGATATTTTTTGGCAAT
GAAAAGGTCCTGAGGCATGCATGGCGAAGTTAGACGCGTTGCGTGCAATAGATAAAACTtggtctacatgtagttgctcttcctcgttgcCCGTACCGCT
GACTTGTATTCACGGCACTTACTAGCCGTCCAACATACGTATACAGCTCCAGGCAGTCCTCACGGATGTTCTGCAGAGCATGATAACATTAGTACCAAAT
TTCCTAGCTAGAACTTCAGCATCAAAACCCGCACGCACGTCCATAGTATCGGCAGTAGtctgctgcatttgctgtagtttgctgtttgtggcGCTGAGCT
CTTCCATTTTGCTTTTCAGAGACTGTTCATACTGTTTGGATGCAAAGCGTTTGTCAGCAATATAGTACAAAGTCGAACGCAACGAGCGACTGCCAACTCA
ATTTACCTGCTGTCGAATGAGAGCGATCTCATTCTCTTTCGATGTTTGCAATGCTGCCACCCGTTGGCGTAGTCTCTGAACAAGAAATACGTGAAATGTT
CTCGTCAGCTGGATGTCCAACTACACGAAGGCAGAGGAATATTTTGCACCTGCTCGAACTGCTTTTCACGATCTTTCGAGGTTACGCCAGCGTCCACTTG
CGGGTTAATGACCGAGCCAGAATGTTGCTGGTAGGGCATCTGACTGTCCATACTAGTGTGCGTCTGGTTGTTTCGACAAAGGAGATACTGCATTTCTCCT
CGATGTCGAGCTGCCTCAGAGGCCAAAGCGCGCTCATACTCActcgacttctgctgcaagcaACTCTCCAGCGTGGCAATCcttcgcttctgctcgtTTA
TGACGCACCGCGCAGTttccttgtccttctttgCTTCAGTCTAGAAACAACAAAGTGGTGAAAAATGGAGGTCGAAAGGAGAACACAGCAATCACCTAGG
CACccaccacgaccaccgtGAAATTGCTTTTTGCGTTGGCATATTTCTGCCGCAAGCGGTCTCGGTCGTTCCGAGTTTCCTCCGCTGTTTTGGTGTAAAC
AAACGTTAAACGTGCTTGGGGTCTTCTGAAGGAATCTCCTTGATCTTCATCTGAAAACACCGACTTCAGCACCAGGCCATCCTACAGCGCAGCAACGTTT
GGTTAACAACTGGCATTCAATTCAATGCAACAGTCCGACGTACAGCAAACTTGATTTCGCCGCTTTCCGATATCTCTTCGGCCTCAAAGCCAAGCTCGTG
CAGTGTGGCGACAAATCGATTGTTGTATTCAGCTCGAACGCCCTCCAGCTGCCGGCGCAAAGCGCTCAACTCTTCTTGAAGCTTACGAATGCGCCGATCC
TTGTCTGCAATAGTACCGTTGATGTGGTTTACGCGAGGCTGCCCACACCGAATCGCTATGTTAGCGTAGAATACGATGAGATCTGTAGTACACTATTGGC
ATCACTTACCTGGTTCTGAACGGATCGGCAACGGTTAGCAAATTGCAGGGTACCCAAGCACTCTTCGTAGTGCTCTTTCATCGGATGAATTGTTGCAATG
AGAGTGGTAAAGCAATTGCCTCCTGCAAGCAAAGGAATAAACAGAAACACTGTTAGATAACGCGGCCAAACAACGAGGCGTTAGTCAAGTACGAACCAAT
ACTGTTCTGTAGGAGACGAGTGAGCTTCGAGTCTCGGTACGGGATGTAGTTGTAGCCGCTCTCTGGGTCCAGCGACATAACAACCTTACCTACAGCGCTC
AAGCTCGAGTTAATGTGTAATGCCTCCTTCAAACGCTGGCCATCCGACTCGCTTTTCTTTAAACGCTCGGATCTAAAAGTCAAGAAGATTGCACACCTGA
ACGTCAGAACCAACAAGTGCGAGCGGAGAAATAGCTGCGTACGTACCCCGCAAGGTCAACCATGTTTAGCATCCCGTAAATCACTTCTTCAGTGTCCCGA
CCTTCGAAATCCAACAGCAAATCACCCCCAGGTTAAATATGTGGGTAAACGTAACGATAGGTAAACTAGCTTGTTACAGCACCTTGTTGAAAGACGTGGA
TGGTAAAAACCGTGTGTGAACGCGACGACACCGCATTCATTTTCGTTTCGTGTGTAGACCGCAGTTTCAGCCCGCATTGCACAATAGCATCTACCTCTTC
TCTTGAGGTTACGGTGACCATGGATAGGTCTTTCACGAAAACTCTGCCTTGAGCATCCTCGTGAATTTCAAAGTTTGCTATAAGCATAGAACCACATAAG
ATCAGAATGAGCCGATAGACTGGTGTCTGAAACTCTGCGAGTTCTTCCTACCTTTTTTGTAATCATagtcttcttctgcttttGGTGGATTCGAGCTGAA
GCTGTTCTCGGAGTACACATGACGTATTGGTAAGTTTTGAGACACATAAGCTCCTCTACAAGGCGCATGCTTACCTTGTGGCACTCTCGGTCCGAGATat
ctgttgttgttgctgttcatTACAAAGGCATCACGTTAACCGTGTCAGCAACTACCAATAACGCACGAGGATACACCGTATCCGATACAGCACTCTAACT
CACTTGACGAAGAAACCATTCAGTACTACTTGAAGTCTGGTATGACACCGGTCGGCCTGTTTTCTTGAGGTAGCTGCATTACTTGTTAGAGAGAGAAAAC
TAGGCGACAAGCAAGGCAGCCTATTGCACCCCATTCTCACGAGACTTACGCTCGTGCGAGATCGCGGACACGATCACAGTAGATTTCCAGAAAACTGACA
ACGAGAGTCACATCCTACTCAACAAAGGACACAATCCCAGAACTAAGTGACACCGTGTTTGAAAAGTAGAAAGCTCTTTACACACCTTGGATTTGCTGTT
TTGGCGATTAACCATATCGAAAAGATATTCAATCGATCGTGACAGTAGCCCCACCTTCTCTCCCCCCGGTTCACCAAAAATACTGCACGTTCAAGCAGTA
GCATCAAATAGATCAACGTCATTTATCTCGTTGTCACAACGTCGATAAAACAAGAACTTGTGGATCCCACTCGACCACAGTGGTTTACCTGAAGGTTTTG
CCTGAACCTGTCTGCCCATACGCAAAACAACAGCTATTGATGCCCTTCAATGCGTAGTCCACCAAGGATTTACTTGTCTGAACGAAGTAATGCGAACAAA
TAAAAGCTTATCAGACGGGAAGTAATTCAGCTACGCGTAGAGCATTTCCACAGAGGTACCGCTTCGAACAATGTTTCTTGAGTTGTGTCAGTCCAGTAGA
CCTATCATCATGGCGTTAAGTGTACAATTCTACCGTAGTTATCACAACAAAATGGGCTGTACATTATCAAAACTGAAGGCGTGGTTTCCGTATTGCATTC
GCTCCGTGTCCTAGGCACACCAAGCACGCACATAAGAGGTTAACTAGCTCTGCAGAAAGCTTTGATATCGCGAGAGTTCCGTACCTTGATCACGATATTG
CTTGGAGTCTCCTTCTTCCGCTCAAACATATCTTCGGGGGCATTCTGGCCGTCAGCACAGGGTCTCGCGCGAACATACACCTACAGTACAGTAACAACGC
GTCCACGAGAGGTATCGATCATCAGCAAAATAGAGCTGTCATCTTTGCAATAAGTGAAGAAGTAGGAGGCTGCCTACCTTGACATTTGCGTTCCCGAGCA
ACCGGGTGTAGTCAGTGGTGACCTTGTGGTCCATGGTTAAAAAGACAACCGCCTCCCTTCTTAGCTTCTTGGTGCCTTCACACGTGGGGTATTTTCAGTT
AGCGTTTCGCAGAAGTGCCTAGCTTGTGCCTCTTCACTAAGCTAGAAGCTGCAACGCACCACGATGGGAGTCGAACCGAGCAACTCGGTCCAATATCTAC
ATAATGTGCTCGCTCATATCCATAATCTTTGTGTGAAAGCCTCCGAAGAAGGTAACACCGACAAACACCAGCAGATTCGAGTCACGCATTGGGTGCGCAA
ACTCCTCAGTCAGCCTATATCTAACCCCACGTGGCTGAAAAGCGTACTAGAGTATGCCAATGTGTTGCTTCAAATGCTACTGGAAGGTGTACGTGTGAAT
GCTCTTGCTACTGTTGCCACGATAACTGATAACATGTTACGATATTCAGGTGATTGGAGAGCCGTTCACGAAAATGCCACCTCAAGGCCCGCTGGCAGCA
CTTCCAAGGTTCCAGGTGAGTCCACACCGACTGCTTAGTGTTAGTTTTCGTGGCTCAAAGCACGAGTATTTGGCATGCTGAACTAGGTTGCACGACTAAC
AAAGGCAGCAAAACAGTTCGTGCGAGCATCGGCAGTAGGAGCTCGCGTCAACCCCGCAAGTCAACGAACACGCAGCAACAATTCAGAAGACGCCGTACAA
GCTGTAGCTGCCGTTCAGACGGTAAGCAAGCAGATCCAGAcacaagaacaagacgatCAGTGGGAATGGCAGCGCGTCTGGAAAGGTGCATTCGACAAAA
TGCACCAGCAGCTACAGTtcacgacggaggagacggagacaTTAGCCACTGAGAACAAGGTGTGCCCTCTTGCCACTTCACCCCCTTCTTTCTTCGTACT
CTTTGGCTGAAATTGCTGCATCGATGTAGGAATTGCGAGCTCTCGTGGCAGGATACAAGAAAGCTCTGGAGGAAGCCGAACGGAAGGAACATGACGTTGA
AACCAAGCACCTCGCCGAGATTGAAAACCTGCGTGCTGTTCACTCACTAGAACTGTCGAATCTGCAAGCTCGTCACCACCAAAAGCTTCAAGAACTGACG
CTGCAGAACGATGAGAAGTTGTTCAGCAGACGACGAGAGAATCACTTTGACCGAcctgcatccagcagcaattcTACGGTGCGTTTGCCGTTATGTATGA
TCTGAAAAAAAGGAAAATTAATTATCTTCTAATCATTATTTTCTTGTTGcaatactacatgtattaataactaGACTCGAGATGATGGAACAAATGCCCA
CTCCGACTTCCTCCAGTATATCGACGCTTTCTACTCGGCCACCTTGGACCTCACTGCGAAAAACAAAGTTTGACATGCTACGTGGCAGTTGATCACTTGA
ATTAAGTATGGTTTCTTACAAACTTCAAGATAGTTTATCTGATCCCTTAAAAGCGATACTTAGCAGCATTTTGCGATAGAAACAAGGAACATCAAGAGCA
CTTCATGGCGTCCAAGGTTCTGCAGGGAGACCCGCGCCGTCCAGGCGACTTGCACCCGTTTGTGCGTGAGCAGGTGGACCCCGACGATGCCCCGGGCGAC
TGGtacgccttcttctcgctcgtACTGGGCTTCCTCGCCTTCACCATGAAAGTACGTCCCGTCAAAATGCATAATATTATTTTCTATATTCTATTCGTAg
ataataataataatttGTTATTTTCGTGTGTATCCTTAGTGGAAGGGGTTGGCCTGGggctcgctgctgctttgcgTGGGCTCGTTCACCAACATGAAGT
CGCAGGATATGAACACGACGCAGGTGGCCAtgtctttcttcttctccacaagcGCCCTCGTGTCCGCCTACATGGGCGCCATGCGTCCCGGAATGCCCAT
GCCCCCATCTGCCCACACGGTCGAAGCCCCCACTTCGTAGACAAGAGAAACATATAGGGAGAGTGTATCCAGCAGGTCCAGAGGTGGCATGCTGTAAGAA
TGGA