Description :
From Genome Similarity Track
Location :
Scaffold_556:10010- 11033
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_556-snap-gene-0.5Ubiquitin carboxyl-terminal hydrolase

Sequence
1023 bases(100 bases per row)
GTGGCGCGACGGACGTGTCGATGACGCTGTCGACCCAGGACGAGGCCATGAACCCGTGCAGCGAGGAGCTCATGGTCGTGGATGACGAGCAGGCAGCAGA
GAAACCGGGTGCAGGTAGCGAACAGCAGGCTGAAGAGACTGCATTAGAGAACGACGACCTGGAGATCCCGCAGACGCCGCCGCCCGTCTCCCATGCGACG
ATCCTGGCGCGCAGTCCTGGGCGCAGCATGCAGTTGGATCCCTCTGGCAGTGCAAAGATGTTCCATTCAGGCAGCAATAATAGCGCCGCGACGTCCATGC
TCACGAGCATCCCTCGCGCGCCGCCGTCGTGTCCGACCGTGACGTTCCACAACGCCTTCCCGCTGCTGACCGACCAGAACCGCATCCAGACAGCGCACCA
GACGGATGCACTTGGCAAGGAGTGGCGTGTGCTCTGGTACCCGCACGGCCACTTCATGGACGACGAAGTCGTCAGCATCTTTGTCGAAATGGTGGTGGCT
GACGACGAGCAGCAGCAGGACGAGGAGAAGAACAAGAGTGACACAACGACGACCATCCCCAGCGATAATGTAGAAAGCGGTGCTGGCGCAACTCGGTTCG
TGGCAGTGGAGATCATTCTGCTGAGCCAAAGTGGAGATCCATCGCGGCATCGACGTCAGATCTCCGAGGTCCACAGGTTCTCGCCCAAGAGCCACGAGTT
CGGCATGAGCAAGTTCTTCGTGCGCAAGGATCTGCTCAACCCCGAGAACGAGTTCCTGACCGCCGATGGGAATGTCGAGGTCGAGATGAACCTGCACACC
GTAGACGGCGCCGACGGCGAGGACGACGAAGGCGTAGCATCGGACAGCTCGACCACAGCGATCTACCCACCGACGAGCCCGTCGATGTCGAACATCGATG
CGTTGGGCGTCGGCAATGACGACACGCTAACGTCGCAATACCTCTCGTACGACTCGAAGACCGAGACTGGCATGGTCGGCCTGAAGAACCAGGGCGCGAC
GTGCTACATGAACTCGCTGCTGC